1 point
3. A city had a population of 150,000 people in 1990. The population
growth of the city is represented by the equation p = 5t + 150, where p is
the population in thousands and t is the time in years since 1990. In what
year will the population have doubled? *
1993
2000
2020
2030
4. What type of correlation is represented by the data in the scatter plot? *
1 point

Answers

Answer 1
300 = 5t + 150
150 = 5t
30 = t
1990+ 30 = 2020





Related Questions

Which of the lines below has an undefined slope? A B 6 с LO D 5 O A. Line A O B. Line B O C. Line C O D. Line D​

Answers

Answer:

B. Line B

General Formulas and Concepts:

Algebra I

Undefined slopes are when x equals a certain number.

Slope-Intercept Form: y = mx + b

m - slope b - y-intercept

Step-by-step explanation:

From the given choices, B is the correct answer.

A has a slope of 0, so m = 0 and would become a horizontal line.

C has a negative slope, so it is not undefined.

D has a positive slope, so it is not undefined.

B shows a vertical line, and so it has an undefined slope.

The link between the bases on a basketball field is 93 a scale drawing shows the distance between the Bases as 1 1/2 to 1 inch on the drawing equals how many feet

Answers

Answer:

Distance on drawing is 11.7 feet.

Step-by-step explanation:

A scale is a factor that can be used to either increase or decrease the size of an object.

Scale = [tex]\frac{distance on drawing}{original distance}[/tex]

Given that:

scale = [tex]\frac{3}{2}[/tex] to 1 inch, and the original distance = 93 inches

So,

[tex]\frac{3}{2}[/tex] : 1 = [tex]\frac{distance on drawing}{93}[/tex]

[tex]\frac{3}{2}[/tex] ÷ 1 = [tex]\frac{distance on drawing}{93}[/tex]

[tex]\frac{3}{2}[/tex] x [tex]\frac{1}{1}[/tex] = [tex]\frac{distance on drawing}{93}[/tex]

distance on drawing = [tex]\frac{3*93}{2}[/tex]

                               = [tex]\frac{279}{2}[/tex]

                               = 139.5

distance on drawing = 139.5 inches

Since 12 inches = 1 foot, then;

Distance on drawing in feet = [tex]\frac{139.5}{12}[/tex]

                                              = 11.625 feet

Distance on drawing is 11.7 feet.

What is the scale factor from triangle A to triangle B??

Answers

Answer:

3

Step-by-step explanation:

i believe this should be the answer, simply because 15÷5 is 3. if you were to find x, you would multiply the scale factor value by the first triangle

due 7:59 am est. Faith is saving up to buy a new bicycle. She already has $40 and can save an additional $6 per week using money from her after school job. How much total money would Faith have after 8 weeks of saving? Also, write an expression that represents the amount of money Faith would have saved in w weeks.

Answers

Answer:

After 8 weeks, Faith would have $88. money saved = 40+6w

Answer:

$88 saved in 8 weeks

Step-by-step explanation:

Part 1:

You would first set up the equation 40 + (6 x 8) = t. T would be the total money saved. You would then do 6 times 8 first, as they're in parenthesis. You would get 48. You now have 40 + 48 = t. You would now add like terms, and you would get 88 = t. You would save $88 in 8 weeks.

Part 2:

40 + 6w = t

w would represent the number of weeks, t would represent the total number of money saved.

-8+15+2x=5+6x-6x

News ASAP
My teacher didn’t teach me this

Answers

Answer:

x = -1 you have to combine like terms.

X=-1 is the correct answer. All you have to do is isolate the variable and divide each side by the factors that don’t contain the variable:)

Anna is testing different weights of certain things. The bucket she is holding that is full of water weighs 5lbs. Anna weighs herself and she is 97 pounds. She then drinks all of the water out of the bucket and then weighs herself again. Now she weighs 104 pounds. If the bucket of water she held was only 5 pounds, how did Anna gain 7 pounds from drinking the water out of it?


__________________________________________________

Answers

Answer:

Anna drank the water and holding the bucket, which weights 2 pounds, so:

97 + 5 + 2 = 104 pounds

Answer:

104 lbs.

Step-by-step explanation:

Anna's self  weight     = 97

Anna drank the water = 5

bucket weights            = 2      

                        total     = 104 lbs.

22. Determine the value of c so that the line
segment with endpoints B(2, 2) and C(9,6)
BC
is parallel to the line segment with endpoints
D(c, -7) and E(5, -3).

help is appreciated !!!

Answers

Answer:(

(-4,-3)

Step-by-step explanation:

You get the negative and subtract from y1 and y2 and then ad x1 with the result of the subtraciton. : ) hope this helps!

Please help! what is an equation of a parabola with x-intercepts at (2,0) and (-7,0) and which passes through the point (1,32)?​

Answers

Answer:

           f(x) = - 4x² - 20x + 56  

Step-by-step explanation:

f(x) = a(x - x₁)(x - x₂)     - factored form of the equation of the parabola with zeros x₁ and x₂

x-intercepts at (2,0) and (-7,0) means zeros: x₁=2 and x₂=-7

So:

f(x) = a(x - 2)(x + 7)     - factored form of the equation of the parabola with x-intercepts at (2,0) and (-7,0)

The parabola passing through point (1, 32) means if x=1 then f(x)=32

Then:

        32 = a(1 - 2)(1 + 7)  

        32 = a(-1)(8)  

        32 = - 8a

         a = - 4

Therefore the equation of a parabola with x-intercepts at (2,0) and (-7,0) and which passes through the point (1,32):

                           f(x) = -4(x - 2)(x + 7)  

Expanding to standard form:

     f(x) = -4(x - 2)(x + 7)

     f(x) = -4(x² + 7x - 2x - 14)  

     f(x) = -4x² - 20x + 56  

The equation of the parabola with x-intercepts at (2,0) and (-7,0) and passes through the point (1,32) is

f(x) = -4 ( x - 2 ) ( x + 7 )

Its standard form is

f(x) = -4x² - 20x + 56.

What is a parabola?

It is a plane curve generated by a point moving so that its distance from a fixed point is equal to its distance from a fixed line

We have,

To find the equation of a parabola we use the factored form of a quadratic equation.

f(x) = a ( x - m ) ( x - n)

Where a is the leading coefficient and m and n are the zeros of the quadratic.

The equation has x-intercepts at (2, 0) and (-7, 0) so we can say that,

m = 2

n = -7

Now the equation passes through (1, 32) = (1, 32) so we have,

32 = a ( 1 - 2 ) ( 1 - (-7) )

32 = a ( -1 ) ( 1 + 7 )

32 = a ( -1 )8

32 = -8a

a = -32 / 8

a = -4

We have,

m = 2

n = -7

a = -4

The equation of the parabola is:

f(x) = a ( x - m ) ( x - n)

f(x) = -4 ( x - 2 ) ( x + 7 )

We can expand to its standard form as:

f(x) = ( -4x + 8 ) ( x + 7 )

f(x) = -4x² - 28x + 8x + 56

f(x) = -4x² - 20x + 56

Thus the equation of the parabola with x-intercepts at (2,0) and (-7,0) and passes through the point (1,32) is f(x) = -4 ( x - 2 ) ( x + 7 ) and its standard form is f(x) = -4x² - 20x + 56.

Learn more about parabola here:

https://brainly.com/question/4074088

#SPJ2

Rita goes for a bike ride on a trail by her house. After 15 minutes of riding she sees a mile marker. When she sees the third mile marker ,she realizes that she has been biking for 30 minutes. What is the rate at which she is riding?

Answers

Answer:

hence, she is riding [tex]\frac{2}{15}[/tex] miles per minute

Step-by-step explanation:

The computation of the rate at which she is riding is shown below:

Given that

Rita covered 1 mile in 15 minutes.

And, her covered 3 miles in 30 minutes.

Now

Let us assume the number of miles covered would be in x minutes

So for one miles the point would be (15,1)

And for three miles, the point is (30,3)

Now the slope of the line is

m equal to

[tex]\frac{y_2 - y_1}{x_2 - x_1} \\\\\frac{3 - 1}{30 - 15} \\\\\frac{2}{15}[/tex]

hence, she is riding [tex]\frac{2}{15}[/tex] miles per minute

What is k? (look at the attached photo for the problem, thank you!!)

Answers

the solution for k would be 12

1 There are 4 trucks for every 5 cars in a parking lot. How many trucks and
cars could be in the parking lot?
A 64 trucks and 80 cars
B
72 trucks and 73 cars
C.
84 trucks and 100 cars
D.
96 trucks and 110 cars

Answers

Answer:

A. 64 trucks and 80 cars

Step-by-step explanation:

The ratio is 4:5 or 4/5, which equals 0.8. Divide the number of trucks by the number of cars to see which other answer equals 0.8. The only one that does is A.

Please answer correctly !!!!!!!!!!!!!!!!! Will mark Brianliest !!!!!!!!!!!!!!!!!!

Answers

Answer:

106°

Step-by-step explanation:

they are parallel to each other

Answer: 106

Step-by-step explanation:

Jasmine found a wooden jewellery box shaped like a right rectangular prism. What is the volume of the jewellery box? MY TEACHER DIDNT TEACH US VOLUME. Ugh. ‍♀️

Answers

Answer:

Volume = Length × Width × Height

Step-by-step explanation:

A right rectangular prism is a three-dimensional object like the one shown in the attachment. It has dimensions: Length, Width and Height. All the angles between the sides are 90°. In order to calculate the volume of an object shaped like a  right rectangular prism, we use the following expression.

Volume = Length × Width × Height

What is the solution set of the following equation?



-8x + x + 15 = -7x + 12

Answers

Answer:

-3 is the solution set of the following equation

4x-2y = 2
3x-2y=-19
Help

Answers

Answer:

{x,y}={21,41}

Step-by-step explanation:

Step by Step Solution:

More Icon

System of Linear Equations entered :

  [1]    4x - 2y = 2

  [2]    3x - 2y = -19

Graphic Representation of the Equations :

   -2y + 4x = 2        -2y + 3x = -19  

 

Solve by Substitution :

// Solve equation [2] for the variable  x

 [2]    3x = 2y - 19

 [2]    x = 2y/3 - 19/3

// Plug this in for variable  x  in equation [1]

  [1]    4•(2y/3-19/3) - 2y = 2

  [1]    2y/3 = 82/3

  [1]    2y = 82

// Solve equation [1] for the variable  y

  [1]    2y = 82

  [1]    y = 41

// By now we know this much :

   x = 2y/3-19/3

   y = 41

// Use the  y  value to solve for  x

   x = (2/3)(41)-19/3 = 21

Solution :

{x,y} = {21,41}

Answer: {x,y}={21,41}

LaShawn solved the equation below to the determine the solution. 3 x minus 8 = negative x + 4 (x minus 2) How many solutions does LaShawn’s equation have? zero one two infinitely many

Answers

Answer: D

D-infinitely many

Step-by-step explanation:

Took the Analyzing Solutions quiz on Edge 2020

Answer: D

D-infinitely many

Step-by-step explanation:

Edge 2020

A retail grocer bought a case of 12 packages of coffee for $52.32.

How much did the retailer pay for each package of coffee?


The retailer sold each package for $12.59.

What is the difference between the retailer’s cost and the selling price for each package of coffee?

Answers

Answer:

4.36

8.23

Step-by-step explanation:

Answer:

4.36

Step-by-step explanation:

Given the function f ( x ) = − 1 x + 3 x 4 , f(x)=− x 1 ​ + 4 3 x ​ ​ , find f ′ ( 4 ) . f ′ (4). Express your answer as a single fraction in simplest form.

Answers

Step-by-step explanation:

The question is not well written. Let us say the function given as expressed as;

f(x) = -1/x + 3/x⁴

f'(x) means we are to differentiate the function with respect to x;

Given f(x) = axⁿ

f'(x) = naxⁿ⁻¹

f(x) = -x⁻¹ + 3x⁻⁴

Applying the differentiation formula we will have;

f'(x) = -1(-x⁻²)+(-4)3x⁻⁴⁻¹

f'(x) = x⁻²-12x⁻⁵

Express as a fraction

f'(x) = 1/x²-12/x⁵

To get f'(4), we will have to substitute x = 4 into the resulting expression

f'(4) = 1/4²-12/4(5)

f'(4) = 1/16-12/20

f'(4) = 1/16-3/5

Find the LCM

f'(4) = (5-48)/80

f'(4) = -43/80

Note that the function used was assumed but the same method can be employed to any other functions.

To anyone reading this HAVE A GOOD DAY

Answers

Answer:

Thank you!

Step-by-step explanation:

I hope you have a good day as well :D

Answer:

Thank you :)

Step-by-step explanation:

A trapezoid. Sides R U and S T are parallel.

Examine the trapezoid. Which sides are parallel?

sides RU and ST

sides RS and ST

sides ST and UT

sides RS and UT

Answers

Answer:

Sides RU and ST

Step-by-step explanation:

Just did the quiz

(Wap) Urgent I need help with this question

Answers

Answer:

12.1

Step-by-step explanation:

In this question, we can use the pythagoras theorem to solve it.

the equation is [tex]\sqrt{11^{2}+5^{2} }[/tex] =   slant height.

                                          = 12.1

que es un experimento determinista

Answers

Answer:

Un experimento determinista es aquel cuyo resultado se puede predecir con certeza de antemano, como combinar hidrógeno y oxígeno o sumar dos números como 2 3. Un experimento aleatorio es aquel cuyo resultado se determina por azar.

Step-by-step explanation:

what is a deterministic experiment

A deterministic experiment is one whose outcome may be predicted with certainty beforehand, such as combining Hydrogen and Oxygen, or adding two numbers such as 2 3. A random experiment is one whose outcome is determined by chance.

PLEASE HELP!! BRAINLIEST AND 10 POINTS !!

Answers

Answer:

Give brainliest first then I’ll give the answer

Step-by-step explanation:

In 2014, the enrollment at Luling High School was 625 students. In 2015, the enrollment grew to 650. By what percentage did the enrollment at Luling High School increase from 2014 to 2015?

Answers

Answer:

[tex]\%Increase = 4\%[/tex]

Step-by-step explanation:

Given

[tex]Initial\ Population = 625[/tex]

[tex]Final\ Population = 650[/tex]

Required

Determine the percentage population increase

This is calculated using the following formula:

[tex]\%Increase = \frac{Final - Initial}{Initial} * 100\%[/tex]

[tex]\%Increase = \frac{650 - 625}{625} * 100\%[/tex]

[tex]\%Increase = \frac{25}{625} * 100\%[/tex]

[tex]\%Increase = \frac{25* 100\%}{625}[/tex]

[tex]\%Increase = \frac{2500\%}{625}[/tex]

[tex]\%Increase = 4\%[/tex]

Hence, there is a 4% increment from 2014 to 2015

Anthony has 115 books in his room. he is storing them in boxes. Each box holds 17 books How many boxes does Anthony need?

Answers

Answer:

7 boxes

Step-by-step explanation:

using the same application you used in part f, reflect the line segment across the x-axis. then, rotate it 90° clockwise. Finally. translate it down 2 units. what is the relationship between the original line segment and the transformed segment ? if you transform a line segment with a seweurnce of reflections, to stations, or translations, is it still a line segment ?

Answers

Answer:

non

Step-by-step explanation:

Find the rate of change of y with respect to the x of the line that passes through points (-28,8) and (-42,15)​

Answers

Answer:

-1/2

Step-by-step explanation:

8-15 = -7

-28 - -42 = 14

-7/14 = -1/2

HELPPPPPPPPPPPP
i give brainliest!

Answers

Answer:

C

Step-by-step explanation:

The scuba diver started at -55 feet as it says below the surface then went up 20 feet so the equation would be -55+20=-35

the answer is C hope this helps :)

Student Council is sponsoring the next school dance. They plan to order 2 cheese pizzas for every 3 pepperoni pizzas they order. How many total pizzas will they order if they plan to order 36 pepperoni pizzas for the dance?

Answers

Answer: 60 pizzas

Step-by-step explanation:

From the question, we are informed that the student council plan to order 2 cheese pizzas for every 3 pepperoni pizzas they order.

Since 36 pepperoni pizzas are ordered for the dance, the number of cheese pizzas ordered will be:

= 36 × 2/3

= 24 cheese pizzas

The total pizza ordered will now be:

= Cheese pizzas + Pepperoni pizzas

= 24 + 36

= 60 pizzas

Answer:

60

Step-by-step explanation:

60 trust me

__ × (-1/2 × ___ = 20​

Answers

Step-by-step explanation:

Thank you 5635e3 guvihbbyi5f4fnuojbubgcr63dd6r

Answer:20x(-1/2x-2)

Step-by-step explanation:

Other Questions
Ayala is making salad dressing. She mixes oil andvinegar in a blender until a smooth consistency isformed. Explain whether this is a heterogeneous or ahomogeneous mixture and why. Help?Jessica must determine how many packages of cookies and cupcakes to buy for her family reunion. Jessica's mother has asked her to buy the same number of each type of item but no more than 100 of each. At the bakery, Jessica finds that cookies are sold in packages of 12 and cupcakes are sold in packages of 9.Use the drop-down menus to select the answers that make each statement true.The greatest number of packages that Jessica can buy is _ packages of cookies and _ packages of cupcakes. explain what happens when particles collide When a story is told from the _____, the narrator has full knowledge of all the characters. omniscient third-person point of view reliable first-person point of view unreliable first-person point of view limited third-person point of view The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut a student performed an experiment, using a cocktail peanut, before it was burned the peanut half weighed .353 g. After burning the residue weighed .016 g. The energy released by the conjunction increased the temperature of 200. mL of water in the calorimeter by 7.2 degrees Celsius. Calculate the mass of peanut consumed in the combustion. twice the sum of k and 9 is 4 The product of a number and -5 is at least 35. Write as an inequality. who killed the district judge during the revolutionary movementanswer in one sentence Quick question for you all People who complain that video games involve too much sitting are probably old. They probably dont know very much about gaming, either. They dont realize that people can play virtual sports, such as tennis, on video games. There are video games for dancing, too. If people bothered to learn about the different kinds of video games, they would see how wrong they are. This students sample paragraph addresses the counterclaim. Critique this paragraph by answering the questions.What is the counterclaim?Video games are too violent.Video games make people inactive.Video games are different today.What evidence weakens the counterclaim?People who complain are old.Sitting too much is bad for people.There are video games for sports and dancing.What is the tone of the rebuttal?respectfulrudehumorous Mention the type of seeds that undergo hypogeal germination.What do we call the process of permanently stopping babies from breast feeding?plzz help it is due today 2) look closely at article XLVII. Rephrase it in your own words. How do you think this impacted the unity among slaves during the revolution?Please I need help! Use the interactive tool to graph the line given the following information: coordinates (1,3) slope of 2Based on your investigation, what is the value of b for the point (0,b)? what is carbogen and it's uses Please help!!!! ASAP!!! Thank you!!! Brainliest to right answer also based on answer 1 are the equations equivalent? help will give brainlyist and 5 star and heart