A hot horseshoe transfers heat to the tongs

Radiation

Conduction

Convection

Answers

Answer 1

Answer:

Radiation is the answer

Explanation:

Answer 2

A hot horseshoe transfers heat to the tongs is the example of Conduction. So, the correct option is B.

What is Conduction?

Conduction is defined as the process by which heat energy is transmitted through collisions between neighboring atoms or molecules which occurs more easily in solids and liquids, where the particles are closer together than in gases. where the particles are further separated.

Some examples of heat conduction are accidentally touching a hot pot, or when a heating pad is applied directly to and heats a muscle or when a hot horseshoe transfers heat to tongs.

During the conduction of electricity, movement of electrically charged particles occur in the medium. The electric current is carried and moved by the ions or electrons.

Thus, a hot horseshoe transfers heat to the tongs is the example of Conduction. So, the correct option is B.

Learn more about Conduction, here:

https://brainly.com/question/12136944

#SPJ2


Related Questions

2. Based on your results, can any conclusions be draw as to the types of habitats likely to contain the most microbes?

Answers

Answer:

Yes.

Explanation:

Yes, conclusions can be drawn from the types of habitats the most microbes likely to present because different microbes needs different types of environmental conditions. Some microbes needs moist and cool environment and can't survive in warm and dry environment while some microbes survive in dry and warm environment and die in moist and cool environment so we can draw conclusion from their habitat types.

Monitoring levels of which two gases would help determine the human
impact on air quality?
A. Methane
B. Water vapor
C. Carbon dioxide
D. Oxygen

Answers

Answer:

A. Methane  

C. Carbon dioxide

Explanation:

Methane and carbondioxide are the two gases that determine the human  impact on air quality because these gases are produced due to human activities. Methane gas is used in homes for cooking and heating purpose while on the other hand, carbondioxide gas is released from burning of fossil fuels in the engine of vehicles and industries for making different products. These two gases greatly affect air quality.

Answer:

a and c your welcome my children

Explanation:

Do all three bird species occupy the same niche? Explain .

Answers

Answer:

None of the birds have the same niche.

Explanation:

They all have different niches because of the food they ate. Over time, they were gentically changing to adapt to their own food.

Which of the following is the major concern with utilizing forensic DNA testing?
O keeping Innocent people out of all
treating genetic diseases as early as possible
a violation of privacy
a violation of the law

Answers

Answer: a violation of privacy

Explanation:

A person's DNA cannot be changed as it is their genetic information. It is therefore their most private information and when it is utilized in forensic DNA testing, it runs the risk of invading a person's privacy.

Forensic DNA testing works by comparing the subject DNA with a DNA database. Using this database means going through the DNA of millions of people without their consent.

This is their most private information and it is being stored and accessed without permission. Critics say that this is a violation of privacy and many studies have showed that this is a major concern

Which of the following statements is true? The shape of DNA is a triple helix. DNA mutations never affect an entire chromosome. Mutations in egg and sperm cells are inherited by offspring. Reginald Punnett discovered patterns of inheritance during pea plant experiments.​

Answers

Answer:

Reginald Punnet discovered patterns of inheritance during pea plant experiments

Explanation:

is there more than one right answer

✧・゚: *✧・゚:*  Answer:  *:・゚✧*:・゚✧

✅ Reginald Punnett discovered the theory of incomplete dominance during flower experiments.   ~ ₕₒₚₑ ₜₕᵢₛ ₕₑₗₚₛ! :₎ ♡ ~

Can the change in cyclin concentration during mitosis be explained by the fact that the cell divides in two and thus divides the material in the cell into two smaller volumes

Answers

Answer:

No, because cell division is expected to decrease not only the net amount of cyclin molecules in daughter cells but also the volume of these daughter cells compared to the original parent cell, and therefore the concentration should be nearly equal.

Explanation:

When a cell divides to produce two daughter cells, the cell components including its previously duplicated genetic material (DNA), organelles, signaling molecules, fatty acids (lipids), proteins, etc., are distributed into daughter cells. These daughter cells have a smaller volume compared to the original parent cell. In consequence, the concentration of cellular components (including cyclin proteins) should be similar between parent cell and daughter cells.

3. Scientists who study the cell cycle use fluorescent dyes and lasers that enable them to measure the DNA content of individual cells. They can count the number of cells with 2N and 4N DNA content, as well as in between 2N and 4N (greater than 2N, but not quite 4N yet). a. In what phase(s) of the cell cycle will cells have 2N DNA content

Answers

Answer:

G1 phase

Explanation:

The cell cycle is divided into 2 major phases

1. The interphase

2. The m phase

The interphase, in chronological order, is further subdivided into

G1 phaseS phaseG2 phase

Cells grow and develop at the G1 phase while the G2 phase is characterized by protein synthesis in addition to continued growth.

The DNA of a cell in interphase is doubled at the S phase. This means that if a cell has a 2N amount of DNA at the beginning of the S phase, the amount of DNA at the end would have become 4N. This amount of DNA is shared into 2 daughter cells in equal amounts during mitosis or the m phase, meaning that each daughter cell would have a 2N amount of DNA before entering the interphase.

Hence, cells will have 2N DNA content in a period that spans through the end of the m phase of the cell cycle to the beginning of the S phase of the same cycle. This means that cells at the G1 phase would be the ones with 2N DNA contents.

Cell grows and prepare itself for replication in the G1 phase cell cycle. In G1 phase of cell cycle, cell is in 2n state.

Cell Cycle:

Cell cycle is the life cycle of the cell in which cell grow and divide. This completes in 2 phases,

InterphaseM- phase

Interphase:

Cell grows in this phase and prepare to divide. This includes 3 phases,

G1 phase In this phase cell, grow and prepare for replication.S- phase : Cell synthesizes its DNA via replication. In S- phase cell is in 4n stage. G-2 phase: Cell prepares itself for division.

M- phase:

Cell condenses its chromosome and divide into 2 cell.Since, cell replicates its DNA in S-phase.

Therefore, in G1 phase of cell cycle, cell is in 2n state.

To know more about the cell cycle, refer to the link:

https://brainly.com/question/11009129

Scientists find the fossilized remains of a fish in the middle rock layers of a research site. They find the fossil of an insect in the lowest rock layers.
What can be concluded from this evidence?

A. the insect lived before the fish

B. the insect lived on the bottom of the ocean that the fish lived in

Answers

It is A I think the insect lived first and so it is under because it is under a different layer so if they were around at the same time and the fish was just under water it would be in the same layer of rock but because it is different rock it was not around at the same time

Empathy means that you can communicate well with others.
A.
True
B.
False

Answers

Answer:

A. true

Explanation:

i mean if you have empathy then yeah it's true

Answer:

A

Explanation:

It means you have the ability to feel what someone is experiencing.

Two rabbits have different parents. One rabbit has ears that flop over, and the other rabbit has ears that stand straight up. Why do the rabbits have ears with different shapes?

Answers

Answer:

The rabbits have different versions of the gene for ear shape, which instruct for different proteins that make differently shaped ears. A Father sheep has curly wool while a Mother sheep has straight wool.

Explanation:

I majored in Biology

Answer:

Explanation: Each rabbit has a different ear shape because they have different versions of the gene for ear shape that connect together to make different ear shapes. - D

I don’t understand how to do this

Answers

Answer:

Translation: GAUGCUUCCAACGACCACTA

Transcription:

GTACGAAGGTTGCTGGTGAT

GATGCTTCCAACGACCACTA

Explanation:

A change in DNA could alter the amino acid order which will affect the folding of the protein, and therefore it's function.

Answers

Answer:

true

Explanation:



Match each cloud type with its image.

Cirrus
Cumulus
Stratus
Cumulonimbus
Fog

Answers

The name of the clouds with respect to its image are given below:

A ----- Cumulonimbus.B ----- Stratus.C ----- Cirrus.D ----- Fog.E ----- Cumulus.

What do you mean by Clouds?

Clouds may be defined as an observable mass of particles of crystallized vapor suspended in the atmosphere of a planet or moon.

The major function of the clouds is to prevent yourself from the sun's intense heat during the day while to limiting the extremely cold at night.

Therefore, it is well described above.

To learn more about Clouds, refer to the link:

https://brainly.com/question/1783904

#SPJ2

Which molecule in the equation represents food energy made by plants? A Carbon dioxide B Water C Glucose D Oxygen

Answers

Answer: Glucose

Explanation: Photosynthesis is a set of chemical reactions that uses energy from the sun and carbon dioxide to produce sugar and oxygen. The sugar provides plants with energy to grow.

Difference between second level consumer and third level consumer

Answers

Answer:

Second-level Consumers - consumers that get their energy from first-level consumers and/or producers. Carnivores - organisms that eat only other animals. Third-level Consumers - consumers that eat second-level consumers and/or first-level consumers.

Chromosome structure can be microscopically observed best during​

Answers

i believe the answer is mitosis

Matter and energy always flow from the
in ecosystems.
A. consumers to the producers
B. heterotrophs to the autotrophs
C. autotrophs to the consumers

Answers

Answer: When organisms use organic matter for cellular respiration, ALL the goes back into carbon dioxide, water, and minerals, while ALL the energy leaves the ecosystem as heat. So matter cycles, energy flows through ecosystems. So It is C

Explanation: A. The producers generate food for themselves and others; consumers do not produce anything, instead eating producers, other consumers or both.

B. Autotrophs make food for their own use, but they make enough to support other life as well.Heterotrophs cannot make their own food, so they must eat or absorb it.

So C is correct

Matter and energy always flow from the in ecosystems from autotrophs to the consumer.

What is ecosystem?

The energy flow in the ecosystem is one of the important factors that enables the survival of such a huge number of animals. An ecosystem is made up of a network of connections between living and non-living elements.

All of the energy needed by living things is provided by the sun. About 1% of all radiant energy is absorbed by green plants and distributed throughout the ecosystem.

According to the first law of thermodynamics, energy cannot be generated or destroyed. The energy source, in this case solar energy, cannot be created or destroyed. It can only be moved from one system to another, just like a form is moved from one form to another.

Therefore, Matter and energy always flow from the in ecosystems from autotrophs to the consumer.

To learn more about energy, refer to the link:

https://brainly.com/question/1932868

#SPJ2

What is the difference between plastic CONSUMPTION and plastic WASTE?

Answers

Answer:

plastic consumption is like using a lot of plastic and plastic waste is when you throw out a lot.

Explanation:

consumption means like eating /using

waste means throwing out / not really using

hope this helped. btw I'm not sure if this is right but I hope it is!

Explain what happened to the spread of the infection as more individuals were vaccinated.

Answers

Answer: As a result of more people being vaccinated the spread of the infection slowed down.

PLEASE HELP 47 POINTS ASAP

There is an amusement park based on sea life. Its purpose is to get the public interested and caring about conservation of the world’s oceans. Some of the profits from this organization go toward funding ocean research and conservation. In order to get people interested, some of the shows that the park offers include large marine mammals that do tricks. Some of the larger marine animals are housed in pools for viewing instead of being allowed to live in their natural habitat. They also have rare and endangered species on display to help increase awareness of them. They even have a breeding program for the some of the endangered animals.

Describe an ethical concern that would be related to this park.

Answers

Answer:

The animals don't know outside of that habit because that where they were born. If they were to be released they would die because they are not used to having to fend for themselves.

Explanation:

Explain how the structure of DNA is important in the synthesis

Answers

Answer:

DNA is the primary genetic material contained within your cells and in nearly all organisms. It's used to create proteins during protein synthesis, which is a multi-step process that takes the coded message of DNA and converts it into a usable protein molecule.

Explanation:

Where are the photoreceptors located inside a human eye?​

Answers

Explanation:

retina

photoreceptor; rod and cone

Rods and cones are photoreceptive cells located in the retina of the eye.

I NEED HELP The measure of how resistant a solid is to shape change when a force is applied.

Answers

Hardness is a measure of how resistant solid matter is to various kinds of permanent shape change when a force is applied Macroscopic hardness is generally characterized by strong intermolecular bonds, but the behavior of solid materials under force is complex; therefore, there are different measurements of hardness: scratch hardness, indentation hardness, and rebound hardness. Hardness is dependent on ductility, elastic stiffness, plasticity, strain, strength, toughness, viscoelasticity, and viscosity. Common examples of hard matter are ceramics, concrete, certain metals, and super hard materials, which can be contrasted with soft matter.

Are you for, against or undecided on GMOs? Explain.
Please give your opinion <3

Answers

Answer:

AGAINST for sure

Explanation:

ive personally raised GMO animals and they have no life. like chickens at the age of 8 weeks the breasts on GMO chickens are so large they are unable to walk and if u do not butcher them they will have heart attacks at around 9 weeks. they also dont get to go outside and walk around bc that makes them lose weight. so most of the GMO chickens do not get to go outside and actually have clean air. let alone see the sun light and stand in grass.

Someone please help me

Answers

Answer:

Your answer is D) Graduated Cylinder.

Answer:

Graduated cylinder

Explanation:

Liquid volume is typically measured using specific tool called graduated cylinder.

At a warm front warm air meets and moves cold air

Answers

what? what u need?!!!!


Citrus trees create their seed by a method of asexual reproduction by a process called

Answers

Answer:

Some plants can produce seeds without fertilization. Either the ovule or part of the ovary, which is diploid in nature, gives rise to a new seed. This method of reproduction is known as apomixis. An advantage of asexual reproduction is that the resulting plant will reach maturity faster.

Explanation:

Answer:

Apomixis

Explanation:

Apomixis is the method of asexual reproduction.

Hope this is correct, have a great day.

Why is crossing over of the chromosomes during meiosis
important?

Answers

Because it increases the genetic variability, offering more combinations of genotypes.

Which is a step of the scientific method in environmental science? A. Testing a hypothesis B.Carrying out research C.Collecting ideas from boocks is a step in the scientific method. The step that follows this step involves forming A.a judgment B.a conclusion C .notes .

Answers

Answer:

The correct answer is Option B (Carrying out research). The step that follows this step involves forming B.a conclusion

Explanation:

The Natural environment  around us is a function of both the living things and the non-living things. So, environmental science is the study of the natural environment around us. This study includes how to tackle environmental problems and further study on how humans could be impacted by the interactions with their environment. The scientific method is a step taken towards ensuring development in a field by bringing new discoveries and challenging existing beliefs through scientific tests and research. Generally, for most scientific methods of many fields, it starts with:

1. Observations

2. Making inquiry which involves asking questions

3. Forming a hypothesis, which means making untested assumptions

4. Conducting an experiment to check the hypothesis

5. Analyze the results

6. Publish the results

The correct answer is Option B (Carrying out research). Because it involves the scientific method highlighted above. The step that follows this step involves forming B.a conclusion

Economic impact of aflatoxin on health and agriculture

Answers

Answer : contamination in crops results mainly from a reduction in marketable volume

Aflatoxin consumed contributes to the mutagenic , carcinogenic , teratogenic , and immunosuppressive health effects in humans.

The direct economic impact of aflatoxin contamination in crops results mainly from a reduction in marketable volume, loss in value in the national markets, inadmissibility or rejection of products by the international market, and losses incurred from livestock disease, consequential morbidity and mortality.
Other Questions
16. Which 2 gods/goddesses would you want on your side in battle? * If c= 16, solve for b. (Timed!!!) Pls help me Im failing math Michael and Daniel are on a team together. Michael scores 5 points on his turn, but Daniel loses 5 points on his turn. A.Model this scenario using a number line. *B.Model this scenario using an equation.C.Explain what the team score would be, and why. PLEASE!!! HURRY. GIVING BARINLISTS!Glucose gives a plant _____ so it can grow.A. chlorophyllB. energyC. oxygenD. foodE. sunlight What are the 3 primary states of matter? WHICH FUNCTION BEST REPRESENTS THIS GRAPH? Solve this system of linear equations: 4x - 2y = 8y = 3/2x - 2(If you explain simply and correctly, I'll give extra points) 27 8/9 divided by 6 5/8 PercentsMichael is leaving a 15% tip for his waitress. What percent of theoriginal price will he pay? Write your answer as a percent, decimal,and fraction. In Scene 2, what does the fact that the fire in Scrooge's home is"weak" help you understand about Scrooge?Christmas carol movie Help me to answer this... [tex]x \: is \: \: twic e \: of \: y[/tex] Acamera's shutter speed can control exposure. You can use shutter speed to createmotion, freeze action, and smooth water effects. Discuss situations when you would use a high shutter speed or a low shutter speed. The daily water consumption for an Ohio community is normally distributed with a mean consumption of 850,125 gallons and a standard deviation of 64,190 gallons. The community water system will experience a noticeable drop in water pressure when the daily water consumption exceeds 934,672 gallons. What is the probability of experiencing such a drop in water pressure? (Round your answer to 4 decimal places. Round Z-scores to 2 decimal places.) what is the sum of this sequence 1+3+5+7+...+999 somebody please help me!!!!! The slope of the line tangent to the curve 3x^2-2xy+y^2=11 at the point (1, -2) is ? Please give me the correct answer Explain why crinoid fossils can be found on the shore of Lake Michigan, which is a fresh water lake.