Describe and give an example of mutualism.


Describe and give an example of commensalism.


Describe and give an example of parasitism.


Describe and give an example of competition.


Describe and give an example of predation.

Answers

Answer 1

Answer:

Mutualism - Bee to flower. Bee eats - flower reproduces

Commensalism - Tree Frog to plant or tree. Frog uses plant for protection.

Parasitism - Flea or tick to host. Parasite feeds off host.

Explanation:

Competition - relationship between organisms that strive for same resources. intraspecific and interspecific. ex) two males competing for mates.

predation - one organism kills and consumes another. wolf hunting moose, cat hunting mouse. venus fly trap killing insect


Related Questions

There are two identical, positively charged conducting spheres fixed in space. The spheres are 40.4 cm apart (center to center) and repel each other with an electrostatic force of F1=0.0720 N . A thin conducting wire connects the spheres, redistributing the charge on each sphere. When the wire is removed, the spheres still repel, but with a force of F2=0.115 N . The Coulomb force constant is k=1/(4π????0)=8.99×109 N⋅m2/C2 . Using this information, find the initial charge on each sphere, q1 and q2 , if q1 is initially less than q2 .

Answers

Answer:

[tex]q_1=5.64\times 10^{-7}\ \text{C}[/tex] and [tex]q_2=2.32\times 10^{-6}\ \text{C}[/tex]

Explanation:

[tex]F_1=0.072\ \text{N}[/tex]

[tex]F_2=0.115\ \text{N}[/tex]

r = Distance between shells = 40.4 cm

[tex]q_1[/tex] and [tex]q_2[/tex] are the charges

[tex]k[/tex] = Coulomb constant = [tex]8.99\times10^{9}\ \text{Nm}^2/\text{C}^2[/tex]

Force is given by

[tex]F_1=\dfrac{kq_1q_2}{r^2}\\\Rightarrow q_1q_2=\dfrac{F_1r^2}{k}\\\Rightarrow q_1q_2=\dfrac{0.072\times 0.404^2}{8.99\times 10^{9}}\\\Rightarrow q_1q_2=1.307\times 10^{-12}\\\Rightarrow q_1=\dfrac{1.307\times 10^{-12}}{q_2}[/tex]

[tex]F_2=\dfrac{kq^2}{r^2}\\\Rightarrow q=\sqrt{\dfrac{F_2r^2}{k}}\\\Rightarrow q=\sqrt{\dfrac{0.115\times 0.404^2}{8.99\times 10^{9}}}\\\Rightarrow q=1.44\times 10^{-6}\ \text{C}[/tex]

[tex]q=\dfrac{q_1+q_2}{2}\\\Rightarrow q_1+q_2=2q\\\Rightarrow q_1+q_2=2\times1.44\times 10^{-6}\\\Rightarrow q_1+q_2=2.88\times 10^{-6}[/tex]

Substituting the above value of [tex]q_1[/tex] we get

[tex]\dfrac{1.307\times 10^{-12}}{q_2}+q_2=2.88\times 10^{-6}\\\Rightarrow q_2^2-2.88\times 10^{-6}q_2+1.307\times 10^{-12}=0\\\Rightarrow \frac{-\left(-0.00000288\right)\pm \sqrt{\left(-0.00000288\right)^2-4\times \:1\times \:1.307\times 10^{-12}}}{2\times \:1}\\\Rightarrow q_2=2.32\times 10^{-6}, 5.64\times 10^{-7}[/tex]

[tex]q_1=\dfrac{1.307\times 10^{-12}}{q_2}=\dfrac{1.307\times 10^{-12}}{2.32\times 10^{-6}}\\\Rightarrow q_1=5.63\times 10^{-7}[/tex]

[tex]q_1=\dfrac{1.307\times 10^{-12}}{q_2}=\dfrac{1.307\times 10^{-12}}{5.64\times 10^{-7}}\\\Rightarrow q_1=2.32\times 10^{-6}[/tex]

Since we know [tex]q_1<q_2[/tex]

[tex]q_1=5.64\times 10^{-7}\ \text{C}[/tex] and [tex]q_2=2.32\times 10^{-6}\ \text{C}[/tex].

A sample contains 20 kg of radioactive material. The decay constant of the material is 0.179 per second. If the amount of time that has passed is 300 seconds, how much of the of the original material is still radioactive? Show all work

Answers

Answer:

6,000 kg

Explanation:


If I ride my bike at 10 mph and traveled 5 miles, how long did I ride in both hours and
minutes?

Answers

1/2 hour or 30 minutes is your answer!

A baseball is thrown at a 28° angle and an initial velocity of 70 m/s. Assume no air resistance. What is the vertical component of the ball’s velocity? What is the horizontal component of the ball’s velocity?
0 m/s; 70 m/s
61.8 m/s; 32.9 m/s
32.9 m/s; 61.8 m/s
70 m/s; 0 m/s

Answers

Answer:

answer is 61.8 m/s; 32.9

l am not sure

What is the force on a 5-kilogram ball that is falling freely due to the pull of gravity?

Answers

Answer:

Force = 49N

Explanation:

Force is given by the multiplication of mass and acceleration.

Mathematically, Force is;

[tex] F = ma[/tex]

Where;

F represents force measured in Newton.

m represents the mass of an object measured in kilograms.

a represents acceleration measured in meter per seconds square.

Given the following data

Mass = 5kg

We know that acceleration due to gravity = 9.8m/s²

To find the Force:

[tex] F = 5*9.8 [/tex]

Force = 49N

When does acceleration due to gravity equal 9.8 m/s downward?
Select one:
a. always
b. when an object has been dropped downward
c. when an object has been thrown upward
d. at the peak of a thrown object's flight

Answers

Answer:

b

Explanation:

i took the quiz i think its right

which refers to information gathered by the systematic study of nature?

prediction
communication of facts
scientific knowledge
hypothesis

Answers

Answer:

it is scientific knowledge

Explanation:

got i right on edge

The scientific knowledge refers to information gathered by the systematic study of nature.

What is scientific knowledge?

A generalized corpus of laws and ideas developed employing the scientific method to describe an interesting occurrence or behavior is referred to as scientific knowledge.

What is systematic study?

Science would be the systematic study of the composition and dynamics of the physical as well as the natural world via experimentation and observation.

the systematic study of natural circumstances and phenomena. empirical proof. the term for the facts and figures that support an explanation in science.

Therefore, the correct answer will be option (C)

To know more about scientific knowledge.

https://brainly.com/question/10601194

#SPJ2

A bullet is fired horizontally at a height of 2 meters at a velocity of 930 m/s. Assume no air resistance. How long until the bullet reaches the ground?


0.32 s
0.57 s
0.64 s
0.25 s

Answers

Should be 0.64 seconds

A seated musician plays a C4 note at 262 Hz . How much time Δ does it take for 346 air pressure maxima to pass a stationary listener?

Answers

Answer:

t = 1.32 s

Explanation:

We are given;. Frequency of C4 note; F_c = 262 Hz

In conversions, we know that 1 Hz = 1 cycle/s

Thus, F_c = 262 cycles/s

Now, we want to find out how much time it takes for 346 air pressure maxima to pass a stationary listener.

346 air pressure maxima denotes that the air pressure maxima is 346 cycles.

Thus, time will be;

t = 346 cycles/262 cycles/s

t = 1.32 s

The time taken for the musical note to pass the stationary listener is 1.32 s.

The given parameters:

frequency of the C4 note, f = 262 Hzair pressure maximum, n = 346

The frequency of a sound wave is defined as the number of cycles completed per second by the wave.

[tex]F = \frac{n}{t}[/tex]

where;

t is the time to compete the maximum cycle

The time taken for the musical note to pass the stationary listener is calculated as follows;

[tex]262 = \frac{n}{t} \\\\t = \frac{n}{262} \\\\t = \frac{346}{262} \\\\t = 1.32 \ s[/tex]

Thus, the time taken for the musical note to pass the stationary listener is 1.32 s.

Learn more here:https://brainly.com/question/15613196

Two stars in a faraway part of the Milky Way are orbiting each other as a binary star system. By
careful measurement we find out that they are separated by 1.7 AU. We also determine that
their orbital period is 594 Earth-days. The total mass of the two-object system is

Answers

Answer: [tex]M_{total}=[/tex] 1.85

Explanation: Estimate the total mass of a binary system is done by a reformulation of Kepler's Third Law, which states that the square of the period of a planet's orbit is proportional to the cube of its semimajor axis, i.e.:

[tex]a^{3}=(M_{1}+M_{2})P^{2}[/tex]

where

a is semimajor axis in astronomical units (AU);

P is period measured in years;

[tex]M_{1}+M_{2}[/tex] is total mass of the two-stars system;

For the two stars faraway in the Milky Way:

1 year is equivalent of 365 days, so period in years:

[tex]P=\frac{594}{365}[/tex]

P = 1.63 years

Calculating total mass:

[tex]a^{3}=(M_{total})P^{2}[/tex]

[tex]M_{total}=\frac{a^{3}}{P^{2}}[/tex]

[tex]M_{total}=\frac{1.7^{3}}{1.63^{2}}[/tex]

[tex]M_{total}=[/tex] 1.85

The total mass of the two-object system is 1.85 mass units.

Having established that a sound wave corresponds to pressure fluctuations in the medium, what can you conclude about the direction in which such pressure fluctuations travel?A) The direction of motion of pressure fluctuations is independent of the direction of motion of the sound wave.B) Pressure fluctuations travel perpendicularly to the direction of propagation of the sound wave.C) Pressure fluctuations travel along the direction of propagation of the sound wave.D) Propagation of energy that passes through empty spaces between the particles that comprise the mediumDoes air play a role in the propagation of the human voice from one end of a lecture hall to the other?a) yesb) no

Answers

Answer:

None of them: the direction of the pressure fluctuations is parallel to the direction of motion of the wave

Explanation:

1. When asteroids collided some of the broken materials fall into Earth's orbit. What do
astronomers call the debris when it hits planet Earth?
(2 Points)
meteors
meteoroids
meteorites
metabots

Answers

i believe it is meteoroids

Before they meet Earth -- meteoroids

While they're falling -- meteors

After they hit the ground -- meteorites

Microwave ovens have a plate that rotates at a rate of about 7.0 rev/min. What is this in revolutions per second?

Answers

Answer:

The value is  [tex]w = 0.1167 \ rev/second[/tex]

Explanation:

From the question we are told that

    The rate at which the plate rotates is  [tex]w =7.0 \ rev/min[/tex]

Generally the revolution per second is mathematically represented as

       [tex]w = \frac{7.0}{60}[/tex]

=>    [tex]w = 0.1167 \ rev/second[/tex]

You've just put a new wood floor in your house. An object will dent the flooring if the stress--the force divided by the area--exerted by the object is great enough.
A) Find the stress produced by a 50 kg woman in high-heeled shoes (assume a circular heel pad 0.50 cm in diameter) with all of her weight on one heel.
Express your answer with the appropriate units.
B) Find the stress produced by a 5000 kg African elephant (assume a circular contact area of 40 cm in diameter for one foot) standing on all four feet.
Express your answer with the appropriate units.

Answers

Answer:

The correct answer will be:

(A) 24955495.07 N/m²

(B) 97482.40 N/m²

Explanation:

(A)

The given values are:

mass,

m = 50 kg

diameter

= 0.50 cm

then,

radius,

r = 0.25 cm

 = 0.0025 m

As we know,

⇒ [tex]A = area \ of \ cross \ section[/tex]

       [tex]=\pi r^2[/tex]

and,

⇒ [tex]stress = \frac{mg}{A}[/tex]

On substituting the values, we get

              [tex]=\frac{(50)(9.8)}{\pi (0.0025^2)}[/tex]

              [tex]=24955495.07 \ N/m^2[/tex]

(B)

mass,

m = 5000 kg

radius,

r = 20 cm

 = 0.2 m

Now,

⇒ [tex]stress=\frac{\frac{5000}{4} (9.8)}{\pi (0.2^2)}[/tex]

              [tex]=97482.40 \ N/m^2[/tex]

In the video your blood is compared to a __________________ that delivers oxygen to your body and picks up CO2 to be released out when you breath.

Answers

Answer:

Delivery truck

Explanation:

I’ll give you a star if you answer this question. Which of the following is the best example of work being done
on an object?

Answers

The answer would be C because you are working hard for the object to not move pls mark as brainliest

Suppose that an object undergoes simple harmonic motion, and its displacement has an amplitude A = 15.0 cm and a frequency f = 11.0 cycles/s (Hz). What is the maximum speed ( v ) of the object?
A. 165 m/s
B. 1.65 m/s
C. 10.4 m/s
D. 1040 m/s

Answers

Answer:

Maximum speed ( v ) = 10.4 m/s (Approx)

Explanation:

Given:

Amplitude A = 15.0 cm = 0.15 m

Frequency f = 11.0 cycles/s (Hz)

Find:

Maximum speed ( v )

Computation:

Angular frequency = 2πf

Angular frequency = 2π(11)

Angular frequency = 69.14

Maximum speed ( v ) = WA

Maximum speed ( v ) = 69.14 x 0.15

Maximum speed ( v ) = 10.371

Maximum speed ( v ) = 10.4 m/s (Approx)

If a ball rolls across a table to the left with constant speed, which of the following is true about the force(s) on the ball? (3a1)

Question 10 options:

There cannot be any forces applied to the ball.


There must be exactly one force applied to the ball.


The net force applied to the ball is zero.


The net force applied to the ball is directed to the right.

Answers

Answer:

C. The net force applied to the ball is zero.

Explanation:

From Newton's second law of motion;

F = ma

Where F is the force on an object, m is its mass and a is its acceleration.

Therefore, the force on an object is a product of its mass and acceleration as it travel from one point to another.

Since acceleration relates to the rate of change in velocity to time. Then when the object moves at uniform velocity (especially along a straight path), its acceleration is zero.

So that;

F = m x 0

  = 0

No force is applied on the object.

Therefore for the ball in the given question, the net force applied to the ball is zero because it rolls with constant speed along a straight path.

You are riding a bicycle. If you apply a forward force of 125 N, and you and
the bicycle have a combined mass of 82 kg, what will be the forward
acceleration of the bicycle? (Assume there is no friction.)
I WILL GIVE YOU POINTs

Answers

Answer:

1.52g

Explanation:

Given parameters:

Force  = 125N

Mass combined  = 82kg

Unknown:

Acceleration of the bicycle  = ?

Solution:

From Newton second law of motion suggests that:

   Force = mass x acceleration

  Acceleration = [tex]\frac{force}{mass}[/tex]  = [tex]\frac{125}{82}[/tex]   = 1.52g

Answer:

The answer that was correct for me was A. 55 N pulling left, and 16 N, 17N p

pulling Right

Explanation:

what is gathering and analyzing information about an object without physical contact with the object

Answers

Answer:

Remote Sensing

Explanation:

Can someone help me with my physics

A pendulum is a body that is suspended from a fixed point so that it can swing back and forth through an exchange of kinetic energy and gravitational potential energy. Using 1–2 sentences, explain what happens to the kinetic energy and gravitational potential energy of the pendulum at the highest point and at the lowest point of its swing.

Answers

In a simple pendulum with no friction, mechanical energy is conserved. Total mechanical energy is a combination of kinetic energy and gravitational potential energy. As the pendulum swings back and forth, there is a constant exchange between kinetic energy and gravitational potential energy.

Answer:

Because mechanical energy (the sum of potential and kinetic energy) is conserved, as the kinetic energy increases, the potential energy decreases. The maximum kinetic energy is achieved when the pendulum passes through the lowest point, and the maximum potential energy is achieved at the highest point.

A net force F acts on a mass m and produces an acceleration a. What acceleration results if a net force 4F acts on a mass 6m?

Answers

Answer: The acceleration results if a net force of 4F acts on a mass of 6m is 2/3a.

Explanation:

Force exerted on an object can be defined as a pull or a push on an object which leads to it's displacement. Force is taken to be a vector quantity because it has both magnitude and direction. The formula which can be used to determine force exerted on an object in physics is:

F= mass( kg) × acceleration( m/ s²)

Acceleration is defined as the rate at which the velocity of an object changes. From the formula of force given above it can be determined by making it the subject of formula. Therefore acceleration= Force/ mass.

From the question,

Force= 4F

Mass= 6m

Therefore acceleration= F/m

= 4/6

Acceleration= 2/3a

The required magnitude of acceleration when force is 4F and mass is 6m is 2/3a.

Given data:

The magnitude of net force is, 4F.

The value of mass is, 6m.

Apply the Newton's second law which says that force exerted on an object can be defined as a pull or a push on an object which leads to it's displacement. Force is taken to be a vector quantity because it has both magnitude and direction. The formula which can be used to determine force exerted on an object in physics is

F = ma

a = F/m ..........................................(1)

here, a is the acceleration.

Solving as when the force becomes 4F and mass becomes 6m.

[tex](4F) = (6m) \times a'\\\\a '= \dfrac{4F}{6m}\\\\a '= \dfrac{2}{3}a[/tex]

Thus, the required magnitude of acceleration when force is 4F and mass is 6m is 2/3a.

Learn more about the Newton's Second law here:

https://brainly.com/question/13447525

An unladen swallow that weighs 0.03 kg flies straight northeast a distance of 125 km in 4.0 hours. With the x x direction due east and the y y direction due north, what is the average momentum of the bird (in unit vector notation)?

Answers

Answer:

The average momentum of the bird is 0.26 kgm/s

Explanation:

The formula to be used here is that of momentum which is

momentum (in kgm/s) = mass (in kg) × velocity (in m/s)

The velocity of the bird is

velocity (in m/s) = distance (in meter) ÷ time (in seconds)

distance in meters = 125km × 1000 = 125,000 m

time in seconds = 4 hrs × 60 × 60 = 14,400 secs

velocity = 125000/14400

velocity = 8.68 m/s

momentum (p) = 0.03 × 8.68

p = 0.26 kgm/s

The average momentum of the bird is 0.26 kgm/s

The average momentum of the bird (in unit vector notation) is (0.1842i + 0.1842j) kgm/s.

Total displacement

Since the unladen swallow that weighs 0.03 kg flies straight northeast (that is at a bearing of 45°) a distance of 125 km in 4.0 hours.

Its position vector after 4.0 hours is d = (125kmcos45)i + (125kmsin45)j = (125000 × 1/√2)i + (125000 × 1/√2)j

= (62500√2)i + (62500√2)j.

If the initial position of the swallow is d' = 0i + 0j, then its total displacement after 4 hours is, D = d - d'

= (62500√2)i + (625000√2)j - (0i + 0j)

= (62500√2)i + (62500√2)j m

Average velocity

The unladen swallow's average velocity, v = D/t where

D = total displacement = (62500√2)i + (62500√2)j m and t = time = 4.0 hours = 4 × 60 min/hr × 60 s/min = 14400 s

So, v =  [(62500√2)i + (62500√2)j m]/14400 s =  (88388.35)i/14400 + (88388.35)j /1440

= 6.14i + 6.14j m/s

Average momentum

The average momentum of the unladen swallow is p = mv where

m = mass of unladen swallow = 0.03 kg and v = average velocity = 6.14i + 6.14j m/s

So, p = mv

p = 0.03 kg × (6.14i + 6.14j m/s)

p = (0.1842i + 0.1842j) kgm/s

So, the average momentum of the bird (in unit vector notation) is (0.1842i + 0.1842j) kgm/s.

Learn more about average momentum here:

https://brainly.com/question/25941500

It has been suggested that rail guns based on this principle could accelerate payloads into earth orbit or beyond. Find the distance the bar must travel along the rails if it is to reach the escape speed for the earth (11.2 km/s).
Let B = 0.86 T , I = 2300 A , m = 20 kg , and L = 55 cm . For simplicity, assume the net force on the object is equal to the magnetic force, as in parts A and B, even though gravity plays an important role in an actual launch into space.
Express your answer using two significant figures.

Answers

Answer:

The distance of the bar D = 1153 km

Explanation:

The electric force is the one that takes place between electric charges.

The electric force with which two point charges are attracted or repelled at rest is directly proportional to their product, inversely proportional to the square of the distance that separates them and acts in the direction of the line that joins them.

Recall that:

Electrical force(F) = I*B*L

where;

I = the current,

B = the magnetic field strength,

L = the length of the bar

However;

From the second equation of motion,

F = Ma

Since; (F) = I*B*L

Then,

Ma = IBL,

where;

M is the mass;

a is the acceleration

Making the acceleration (a) the subject of the formula, we have

a = IBL/M

Similarly;

From the third equation of motion;

v^2= u^2+2as,

where v and u are the final velocity and the initial velocity respectively

Here u = 0

Also; let distance s = D

Then

v^2 = 2aD

where;

a = IBL/M

Making the distance D  the subject of the formula, we get:

D = v^2/2a = v2*M/(2IBL)

D = 11200² × 20/(2×2300×0.86×0.55)

D = 1153047.155 m

D = 1153 km

In a control system, an accelerometer consists of a 4.63-g object sliding on a calibrated horizontal rail. A low-mass spring attaches the object to a flange at one end of the rail. Grease on the rail makes static friction negligible, but rapidly damps out vibrations of the sliding object. When subject to a steady acceleration of 0.832g, the object should be at a location 0.450 cm away from its equilibrium position.

Required:
Find the force constant of the spring required for the calibration to be correct.

Answers

Answer:

8.4 N/m

Explanation:

m = Mass of block = 4.63 gm

g = Acceleration due to gravity = [tex]9.81\ \text{m/s}^2[/tex]

x = Displacement of spring = 0.45 cm

a = Acceleration of subject = 0.832g

k = Spring constant

Force is given by

[tex]F=ma[/tex]

From Hooke's law

[tex]F=kx[/tex]

So

[tex]ma=kx\\\Rightarrow k=\dfrac{ma}{x}\\\Rightarrow k=\dfrac{4.63\times 10^{-3}\times 0.832\times 9.81}{0.45\times 10^{-2}}\\\Rightarrow k=8.4\ \text{N/m}[/tex]

The force constant of the spring is 8.4 N/m.

If a penny is dropped from rest from a building takes 2 seconds to hit the ground, calculate the velocity of the penny right before it touches the ground?
a. 19.6 m/s
b 9.8 m/s
c. 0 m/s
d 29.4 m/s​

Answers

Answer:

20m/s

Explanation:

u = 0m/s

t = 2s

a = +g = 10m/s²

t = 2d

v = ?

v = ut + 1/2at²

v = 0(2) + 1/2(10)(2)²

v = 0 + 5(4)

v = 20m/s

Resistor is made of a very thin metal wire that is 3.2 mm long, with a diameter of 0.4 mm. What is the electric field inside this metal resistor?

Answers

Complete question:

Resistor is made of a very thin metal wire that is 3.2 mm long, with a diameter of 0.4 mm. What is the electric field inside this metal resistor? If the potential difference due to electric field between the two ends of the resistor is 10 V.

Answer:

The electric field inside this metal resistor is 3125 V/m

Explanation:

Given;

length of the wire, L = 3.2 mm = 3.2 x 10⁻³ m

diameter of the wire, d = 0.4 mm = 0.4 x 10⁻³ m

the potential difference due to electric field between the two ends of the resistor, V = 10 V

The electric field inside this metal resistor is given by;

ΔV = EL

where;

ΔV is change in electric potential

E = ΔV / L

E = 10 / (3.2 x 10⁻³ )

E = 3125 V/m

Therefore, the electric field inside this metal resistor is 3125 V/m

Help!!! Need answer ASAP.

Answers

Answer:

Hey

Explanation:

Write the function y(x, t) that describes this pulse if it is traveling in the positive x-direction with a speed of 2.10 m/s. (Use the following as necessary: x and t. Assume x and y are in meters and t is in seconds. Do not include units in your answer.) y(x, t) = _______.

Answers

Answer:

The function is missing in the question. The function of the transverse pulse in the wire is given by [tex]$y=\frac{6}{x^2 +3}$[/tex]  

Explanation:

A transverse wave can be defined as the wave whose direction of displacement is always perpendicular to the direction of propagation. For example, surface wave at water bodies. While a pulse can be defined as a sudden change in a constant quantity such as a pulse of the radiation or current.

Let the wire of infinite length in both the directions and also the magnitude of deflection of wire be in the same shape except the point of maximum deflection to move along the wire.

Thus the equation of the pulse moving the in the positive x-direction moving at the speed of 2.10 m/s is

[tex]$y=\frac{6}{(x-2.10)^2 +3}$[/tex].

The speed of a space shuttle is 10 / express this in /�

Answers

Answer:

268.22m/s

Explanation:

Given;

    10mile/min to m/s

We need to convert between the two units;

  Using the dimensions;

    1 mile  = 1609.34m

     60s  = 1min

Now;

    10 x [tex]\frac{mile}{min}[/tex] x [tex]\frac{1min}{60s}[/tex] x [tex]\frac{1609.34m}{1mile}[/tex]

  = 268.22m/s

Other Questions
Help?Jessica must determine how many packages of cookies and cupcakes to buy for her family reunion. Jessica's mother has asked her to buy the same number of each type of item but no more than 100 of each. At the bakery, Jessica finds that cookies are sold in packages of 12 and cupcakes are sold in packages of 9.Use the drop-down menus to select the answers that make each statement true.The greatest number of packages that Jessica can buy is _ packages of cookies and _ packages of cupcakes. explain what happens when particles collide When a story is told from the _____, the narrator has full knowledge of all the characters. omniscient third-person point of view reliable first-person point of view unreliable first-person point of view limited third-person point of view The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut a student performed an experiment, using a cocktail peanut, before it was burned the peanut half weighed .353 g. After burning the residue weighed .016 g. The energy released by the conjunction increased the temperature of 200. mL of water in the calorimeter by 7.2 degrees Celsius. Calculate the mass of peanut consumed in the combustion. twice the sum of k and 9 is 4 The product of a number and -5 is at least 35. Write as an inequality. who killed the district judge during the revolutionary movementanswer in one sentence Quick question for you all People who complain that video games involve too much sitting are probably old. They probably dont know very much about gaming, either. They dont realize that people can play virtual sports, such as tennis, on video games. There are video games for dancing, too. If people bothered to learn about the different kinds of video games, they would see how wrong they are. This students sample paragraph addresses the counterclaim. Critique this paragraph by answering the questions.What is the counterclaim?Video games are too violent.Video games make people inactive.Video games are different today.What evidence weakens the counterclaim?People who complain are old.Sitting too much is bad for people.There are video games for sports and dancing.What is the tone of the rebuttal?respectfulrudehumorous Mention the type of seeds that undergo hypogeal germination.What do we call the process of permanently stopping babies from breast feeding?plzz help it is due today 2) look closely at article XLVII. Rephrase it in your own words. How do you think this impacted the unity among slaves during the revolution?Please I need help! Use the interactive tool to graph the line given the following information: coordinates (1,3) slope of 2Based on your investigation, what is the value of b for the point (0,b)? what is carbogen and it's uses Please help!!!! ASAP!!! Thank you!!! Brainliest to right answer also based on answer 1 are the equations equivalent? help will give brainlyist and 5 star and heart (MC)Read the narrative and determine the point of view:"As you walked along the beach with your mom, you knew it was time to tell her the facts about what happened. She may never pardon you for your deceit, but you sense that she deserves to know. You think that to regain her trust, you need to demonstrate responsibility now for what you did and be honest about it." (5 points) aFirst person bSecond person cThird-person limited dThird-person objective eThird-person omniscient