During a group discussion of William Shakespeare’s play Romeo and Juliet, Javier confidently reads aloud a preselected scene. He then adds other facts about the play and offers his opinions. When another student begins to offer another viewpoint, Javier quickly interrupts and restates his facts and opinions. Javier does the same thing when another student attempts to share her ideas.

What statement best describes Javier’s behavior in this discussion?

Answers

Answer 1

The statement that best describes Javier’s behavior in this discussion is: He is well prepared, but needs to follow the rules of the discussion.

In this description of Javier's behavior during the discussion, we find that he is well prepared for the discussion.

However, he needs to apply the spirit of teamwork by giving room to others to air their opinions on the matters being discussed.

So, option A correctly describes Javier's behavior in this discussion.

Learn more about group discussion here:

https://brainly.com/question/2290843

Answer 2

Answer:

A

Explanation:


Related Questions

Which details do the authors include to support the claim in this passage? Select three options.

an explanation of the results of the Seven Years’ War
an explanation of how the Molasses Act benefited colonists
an explanation of what was being taxed and how much it cost
an explanation of why the Americans smuggled molasses
an explanation of why the British imposed the Sugar Act

Answers

Answer:

C, D, E

Explanation:

Just took the quiz

Answer:

the answers are c, d, & e!!!

Explanation:

Create a paragraph by using the following words
Consensus,subtleties , denizens ,incendiary
Can someone answer plzzz

Answers

consensus and subtleties or denizens and incendiary
Explanation:
Because I ain’t never seen 2 pretty best friends

using the way of wealth Compare and contrast immaterialism with idealism

Answers

Answer:Materialism is the view that material objects exist. Idealism is the view that every object either is, or depends for its existence upon, mental entities. Note that, as stated, these aren't opposing views, for it could be that material objects are either identical to or depend upon mental entities for their existence.

Explanation:

EASY POINTS! Which sentence is correct?

Answers

Answer:the second

Explanation:I’m acting dumb I’m tired

"It's just that . . . without the memories it's all meaningless. They gave that burden to me. And to the previous Receiver. And the one before him." "And back and back and back," Jonas said, knowing the phrase that always came. The Giver smiled, though his smile was oddly harsh. "That's right. And next it will be you. A great honor." "Yes, sir. They told me that at the Ceremony. The very highest honor." The Giver by Lois Lowry Part A What is the Giver's point of view about his role in the community?

Answers

Hello. You forgot the answer options. the options are:

The Giver sees the memories as a heavy responsibility.

The Giver is delighted to be trusted by the elders.

The Giver recognizes that his job could not be done by anyone else.

The Giver is respectful of the community’s memories.

Answer:

The Giver sees the memories as a heavy responsibility.

Explanation:

The text above shows how the giver was overwhelmed with having to keep people's memories. This role in society was given to him as something very honorable and that would give him an unparalleled privilege, which would make him admired by the whole society, but none of this seems to make sense to him, since the burden of carrying all these memories and thoughts were too heavy and he feared he would not be able to bear it.

The speaker seems to speak fondly and clearly of her memory of death. What do you think that means about the afterlife? How do you imagine the place where she now speaks from?

Answers

Answer:

Explanation:

I think the afterlife is something peaceful. if it were bad, then she wouldn't say so. I imagine she's somewhere warm. Not weather wise, but warm colors and soft lights. Something pure, a place where she can think, relaxing. which makes it easier to speak so fondly of her death.

(its probably weird my bad lol)

In "Musée des Beaux Arts," who does Auden feel best understands human
suffering?

A. Icarus and Daedalus
B. Poets from the past
C. The "Old Masters"
D. Farmers

Answers

In Musee des Beaux Arts," Auden feel best understands human

suffering from the Old masters Option(c) is correct.

What is the message of Musee des Beaux Arts?

The major theme, or basically the general quote, of this poem is about the nature of human suffering The "miraculous birth" of Christ is very much dominant event which is actively nonetheless associated with the first instances of suffering.

The Musée des Beaux-Arts de Rouen was made soon after the Revolution through the Chaptal Decree of 1801, yet the most vital moves towards framing a public assortment started in 1790. The gallery was at first housed in the Jesuit church and started getting general society in 1799, preceding being moved to the new City Hall, where it was initiated in 1809 with a list of 244 compositions.

The overall collection expanded from 300 pictures in 1823 to 600 "of the exceptionally most noteworthy legitimacy" in 1878, in a gallery presently reffered to as "the most far reaching in France after that of Paris".

Before long there was a squeezing need for another structure. In 1873, the city hall leader dispatched an undertaking from the designer Louis Sauvageot, which prompted the kickoff of another wing in 1880, and in 1888 to that of the complicated that currently houses the gallery and the library.

Therefore Option(c) is correct.

Learn more about Musée des Beaux arts here:

brainly.com/question/3807990

#SPJ5

“ What happens to a dream deferred? Does it dry up like a raisin in the sun? Or fester like a sore-- And then run? Does it stink like rotten meat? Or crust and sugar over-- like a syrupy sweet? Maybe it just sags like a heavy load. Or does it explode?
A Using a dictionary, define the word, “deferred.”
B What is the author asking you with the first question in this poem?
C Using a dictionary, define the word, “fester.”
D Describe the imagery of the sentence, “Or ..fester like a sore.”
E What happens when you let go of a dream? Explain.

Answers

C. Using a dictionary,define the word, “deferred”

based on paragraph 4-6, what can be inferred about mama's character

Answers

She love to sing eat and breathe

How has your education prepared you for the workforce so far?
What sort of things have your teachers done (in regard to expectations, rules, roles, etc.) that will help to prepare you for life outside of the school walls?
What similarities does a school and work environment have? What makes each of these environments different?

give me 3-5 sentences

i might give you brainliest if you got it

Answers

Answer:

it prepare me to stand firm on what you really know

Explanation:

school is different from work cause u go there and pay fees while work u collect your salary or wages

2:school is a place where various school activities can only be done dere

3: work is a place where you go to our out what you learnt back then in school

What are some names the author uses for Lake Titicaca?
jewel of the Andes
heavenly waters
the fairest crown of water
Andean sweet-lake sea

Answers

1 and 4. Glad I could help.

Read the passage from "Initiation."
The door behind her opened and a ray of light sliced
across the soft gloom of the basement room.
"Hey Millicent, come on out now. This is it." There were
some of the girls outside.
"I'm coming," she said, getting up and moving out of the
soft darkness into the glare of light, thinking: This is it, all
right. The worst part, the hardest part, the part of initiation
that I figured out myself.
The passage provides evidence that Millicent has overcome what kind of conflict?
Character vs Character
Character vs Nature
Character vs Self
Character vs Society

Answers

Maybe character vs self???

Answer:

character vs. self

Explanation:

edge 2020 :)

Direction: Watch the video then write 10 Sentences about the video that you learned in the box below.


Liberty's Kids 104 - Liberty or Death
plzzzzz help

Answers

Explanation:

how are we suppost to watch the vid

i need more info to give correct answer

EZ points!! have u read the night chanter or if wanna read it answer any of these just 1 of the questions
a) Discuss the relationship between the grandson and Sam Charley.

OR

b) Identify and explain the effect of the point of view used in the story.

OR

c) Explain how the title is appropriate to the story.

Answers

Answer:

told from the point of view of Ben Benally, Abel's roommate in the apartment in Los Angeles. It is the day after Abel—badly beaten by unknown assailants and left in a ditch on the beach—has left Los Angeles to return to Walatowa. Ben remembers going up on a hill in the city with many Indians the night before. The group, which included Tosamah and Cristobal Cruz, started playing songs and dancing while Abel and Ben went off by themselves. Abel and Ben made a pact to meet sometime in the future, just the two of them and two horses among the hills, and to sing the song called "House Made of Dawn."

Ben gradually reveals the events of the prior weeks. We learn that Abel had been drinking far too much and finally quit working at the factory to spend all his time at bars. One evening, over a poker game at Tosamah's, Abel became so enraged with Tosamah that he tried to hit him. Abel was too drunk, however, and merely stumbled, provoking laughs from the others in the room.

From that point on, Abel descended further into drunkenness and poverty until he had a fight with Ben and left the apartment. Abel and Ben had been mugged by a corrupt local cop earlier that week, and Ben implies that Abel was perhaps intending some sort of revenge when he left the apartment. Regardless of whether or not Ben's guess is correct, Abel returns to the apartment three days later, crashing to the floor of the stairwell, badly beaten and seemingly close to death

How was Buck in "The call of the wild" pampered (examples)

Answers

Answer: Before he was kidnapped, he was a pampered house pet. He was Judge Miller's special pet. The other dogs didn't count. But Buck was neither house dog nor kennel dog.

Answer:

He was allowed to do whatever he wanted in the mayor's(?)/VIP's house. His behaviour was not reprimanded and he always got treats.

Even when he messed up that banquet, he only got a 'mild scolding'.

(I haven't seen the movie in a while)

"Tell-Tale Heart" Compare and Contrast Paragraph

Answers

Answer:The Tell-Tale Heart" and "The Black Cat" both feature an unreliable first-person narrator confessing to a murder, which is discovered when a sound is heard coming from the tomb. "The Black Cat" is the more complex story of the two. The murder is unpremeditated, whereas in "The Tell-Tale Heart," it is carefully planned. Additionally, the narrator in "The Black Cat" is an alcoholic, committing his acts of violence against both the cat and his wife under the influence of alcohol.

Explanation:

pls do my homework im crying so hard because i dont know what they pls help

Answers


This is what I think it is

Please Help!!! No random answers, please!
How is a hero kind? Answer in 2-3 sentences.

Answers

Answer:

A hero helps when others need that help. Also he makes sure that when some one is struggling they always find a way to help just for you, sometimes they make you feel important. One other thing is that they can do things for you when you are to busy for it.

Explanation:

I don't know. Hope this helps! :)

Answer:

A hero is kind because when you are in need of help they always come or try to help you no matter what happens. They always put our needs before theirs, no matter how hard it is. They constantly put their lives at risk to help us or to save others no matter the price.

Explanation:

If you need more just ask me

HELP PLSSSssssssssss

Answers

Answer: Her mother lost interest in life.

Explanation:” And my mother’s dreams had to be buried as well” it’s literally said in the text as a metaphor type of form because the teacher died and her moms dreams died

IDK WHY T.F I'M ASKING BUT PLZ HELP FOR REAL
how is the setting important in “the gentleman of rio en medio”?

Answers

Answer:

the narrator of the story: the agent in charge of selling the property

the first hint of the conflict between Don Anselmo and the Americans: the months were taken to negotiate

What Don Anselmo's dress reveals about him: Although poor, Don Anselmo has dignity

Reason Don Anselmo is known as "Don": "Don" is a title of respect.

A description of Don Anselmo: He wants to be fair to everyone.

Why Don Anselmo refused to take the extra money: In honor, he had already accepted an offer

What the reader can predict from the first meeting: Don Anselmo values his family and will not be hurried into making a decision

The resolution about the land: Each tree is sold to the person for whom Don Anselmo planted it.

The resolution about the land

Each tree is sold to the person for whom Don Anselmo planted it.

The real conflict in the story: The definition of ownership

Don Anselmo's internal conflict: The importance of the land rather than money

Importance of selling the land: Don Anselmo's respect for the buyers

Resolution: The Americans' buying the trees

Is this a metaphor "I was powerless"? Yes or No

Answers

Answer:

It depends on the context but I think it is a metaphor

Explanation:

30 POINTS PLEASE HELP AND USE IN YOUR OWN WORDS <3
Using your understanding of plot, setting, and characters, make a plan for an original novel. Use Freytag’s Pyramid to outline your novel and show how you will explain the premise, introduce conflict, reach a climax point in the action, and then neatly resolve your piece.

Answers

Answer:

In this Chapter we are going to make a plot ladder. It is an idea developed from the exercise in the previous chapter and we are going to make a plot ladder in exactly the same way, by drawing at random a character and a series of actions.  For continuity we will keep the same set of instructions and the same collection of jobs and professions from the previous chapter, but we will use a different job/profession.  At the end of the exercise we will have written from the same material but with a change of character.  The change of character and start point will yield a fresh, new interpretation of the same material.

Key idea: Even if you start in the same place, different characters, coming from various backgrounds, with their own individual wants and needs and attitudes, will not view the same action the same way and so your story will be different.

Explanation:

srry if this dosent help

Which of the following describes what happens on March 21st?
autumnal equinox
winter solstice
vernal equinox
summer solstice
rfmedfkuenhfruiad

Answers

Answer:

vernal equinox

Explanation:

In the northern hemisphere, the spring, or vernal equinox happens around March 21, when the sun moves north across the celestial equator.

The correct response is - the vernal equinox. Therefore option B is correct.

What is the vernal equinox?

The vernal equinox is any of the two places in the sky when the ecliptic (the Sun's annual trajectory) and the celestial equator connect. These two points in the year when the Sun is exactly above the Equator and day and night are of equal length. Energy that is produced using renewable resources won't run out. They are organic, self-renewing, and often leave no or very little carbon imprint.

One of the two equinoxes—the times of the year when the lengths of day and night are almost equal—is the vernal equinox, often known as the spring equinox. The equinoxes take place around March 20–21 and September 22–23, respectively.

Even though the spring and fall equinoxes have different dates in the Northern and Southern Hemispheres, the equinoxes are occasionally referred to as the "vernal equinox" (spring equinox) and the "autumnal equinox" (fall equinox). In the Northern Hemisphere, the equinox in March marks the beginning of spring, and in the South, the fall equinox.

To read more about the vernal equinox, refer to - https://brainly.com/question/28580405

#SPJ6

whats the preposition in the sentence. Throughout his audition, Manny Delgado made sure to keep smiling.​

Answers

Answer:

The preposition is Throughout.

How does Kafka use words with traditionally positive connotations to express negative thoughts?

Answers

Answer:

Kafka uses words with positive connotations negatively by expressing that the words with positive connotations are absent from his colleagues.

Explanation:

hope I help

ILL GIVE BRAINLIEST PLEASE HELPPP..
For this assignment, you will develop a short story that includes at least one time element, three in
three instances of dialogue between two or more characters, and at least one major plotline and one sub-plotline. Your short
story must be four to five complete paragraphs in length. You must use correct spelling, punctuation, capitalization, and
grammar in your work.

Answers

Help I’ll mark you brainly!

Answers to The Progressive Era on CommonLit.

Answers

Answer:

Where is that?

Explanation:

Answer:

Im sorry your gonna need to provide some more info because i dont know any questions on that quiz/test.

sorry!

Why was aram delighted and frightened at the same time

Answers

Answer:

C

Explanation:

Answer:

axwiwidhwfpefgjecj

Explanation:

djdjfyt

What did people realize about themselves?in the story night

Answers

Answer:

night wriiten by who

Explanation:

What activities did the Jim Crow laws affect?

Answers

Answer:

Jim Crow laws affected African American citizens, especially focusing on their right to vote. Even though slavery was outlawed, many states had laws that prevented people from voting and doing other things such as shopping, eating at restaurants, and going to public schools. Segregation was still a thing, and Jim Crow laws stopped many people from overcoming that barrier in society.

Explanation:

Other Questions
During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date. Est ce que quelqu'un pourrait bien corriger mon expression ecrite ou donner son avie dessus s'il vous plait A $10,000 bond with 18%/year, compounded semi-annually (interest is paid every six month) is available in the market. The bond matures in 10 years. The closest PW of this bond if the purchaser can earn 12%/year, compounded quarterly is:_____. My annoying brother likes to drive me crazy. There is no other who is that lazy. He whines to my mom night and day, until eventually gets his way. What is a sister to do, when he screams til he's blue? There is no way to win, for he gets under your skin. He does his best to kill all joy. Oh, how my brother does annoy! What is the tone of the poem PLZ HELP!!!Will mark brainliest44. Show that the quadrilateral with vertices A(0,0), B(a,0), C(a + b, c) and D(b, c) is a parallelogram. hehe i need help with the whole quiz basically:IFind the decimal that is equivalent to: A. 1.714 B. 0.583 C. 0.0583 D. 6. Another engine reaches its top speed from rest in 7.5 s. It is able to perform 250,000 J of wok inthat time How much power does this engine have in that time? The Yellow River is often called the cradle of Chinese civilization. It was along the banks of the Yellow River where the Chinese civilization first formed. The Yellow River is 3,395 miles long, making it the sixth longest river in the world. It is also called the Huang He River.Early Chinese farmers built small villages along the Yellow River. The rich yellow-colored soil was good for growing a grain called millet. The farmers of this area also raised sheep and cattle. Ancient China: Geography,Ken NelsonUsing context clues, which statement best defines the phrase "cradle of Chinese civilization?the place where the longest river in China startsthe place where most people in ancient China livedthe place where people in China began a farming culturethe only place in ancient China where people could farm What is an accurate statement about many of the first Africans to come to Louisiana?They came voluntarily.They were skilled laborers. They came in search of domestic work. They knew how to grow crops. Carter was given a box of assorted chocolates for his birthday. Each night, Carter treated himself to some chocolates. Carter ate 5 chocolates each night and there were originally 30 chocolates in the box. Write an equation for C,C, in terms of t,t, representing the number of chocolates remaining in the box tt days after Carter's birthday. When a space shuttle was launched, the astronauts on board experienced an acceleration of 29.0 m/s2. If one of the astronauts had a mass of 60.0 kg, what net force in Newtons did the astronaut experience? Which equation below has no solution?A) 3(6x + 8) = 24 + 18xB) 8(x + 4) = 12x - 6C) 5x - 4 = 2(4x + 8) - 3x