Find the zeros for the given equation hurry!!!!

Find The Zeros For The Given Equation Hurry!!!!

Answers

Answer 1

Answer:

x = 3 and -1

Step-by-step explanation:

5(x²-2x-3)

(x-3)(x+1)

Answer 2

Answer:

Zero's are: x= 3, -1

Step-by-step explanation:

With factoring, and determining the middle ground, finding the zeroes will come back to this result.


Related Questions

Multiply: (5.8 x 10^-6) x (2 x 10^4).

Answers

Answer:

[tex]1.16*10^{-1}[/tex]

Step-by-step explanation:

[tex](5.8*10^{-6}) *(2*10^{4})\\=11.6*10^{-2}\\=1.16*10^{-1}[/tex]

Who plays Fortnite lookin for a sweaty teammate and plz what’s 638+43+53-363+43-35+737-363 times 647+647 I don’t have a calculator

Answers

Answer:

its -3959202 BTW this answer is :(

Step-by-step explanation:

6443


O Horizontal translation of 11 units
O Reflection across y-axis
O Horizontal translation of 4 units
O Reflection across x-axis

Answers

Answer:

The answer is B

Step-by-step explanation:

I got B because it just looks like its flipped over the y axis. Its also even. Im sorry if you didnt get that but im not the best explainer at these types of problems lol. But its actually b trust me

pls mark brainliest because i didnt waste your time lol

A gas station had two pumps. Pump A dispensed 241,752 gallons. Pump B dispensed 113,916 more gallons than Pump A. About how many gallons did both pumps dispense?

Answers

Answer:

Total gallons= 597,420

Step-by-step explanation:

Giving the following information:

Pump A dispensed 241,752 gallons.

Pump B dispensed 113,916 more gallons than Pump A.

First, we will calculate the number of gallons dispensed by Pump B:

Pump B= Pumb A + 113,916

Pump B= 241,752 + 113,916

Pump B= 355,668 gallons

Now, in total:

Total gallons= 241,752 + 355,668

Total gallons= 597,420

Find the slope of the line y = 2x + 3.
Simplify your answer and write it as a proper fraction, improper fraction, or integer.

Answers

Answer:

proper fraction

Step-by-step explanation:

Sophie and Isadora ride around a circular track that has an inner radius of 30 m. The track is 2 m wide and Isadora rides along the outer lane. How much further does Isadora ride than Sophie, In one lap? Is any one else as confused as I am?

Answers

it’s just the difference in circumferences, so it’d be
S = 2 Pi r
S = 2 * 3.14 * 30
S = 188.4m

I = 2 Pi r
I = 2 * 3.14 * (30 + 2)
I = 200.96m

I - S = 200.96 - 188.4
= 12.56m

Therefore, Isadora had to ride 12.56m more than Sophie

La factura de celular del mes pasado ascendió a un total de $239 por un consumo de 269 minutos de llamada, mientras que la de este mes ascendió a $175 por un consumo de 141 minutos. El importe es la suma de una tasa fija (renta de línea) más un precio fijo por minuto. Calcular la tasa y el precio por minuto

Answers

Answer:

Costo fijo= $104.5

Costo unitario=  $0.5 por minuto

Step-by-step explanation:

Mes pasado:

$239 por 269 minutos

Mes corriente:

$175 por 141 minutos

Primero debemos calcular el cost por minuto de llamada:

Costo unitario= (costo total más alto - costo total más bajo) / (cantidad de minutos más alto - cantidad de minutos más bajo)

Costo unitario= (239 - 175) / (269 - 141)

Costo unitario=  $0.5 por minuto

Ahora, el costo fijo:

Costo fijo= costo total más alto - (costo unitario*cantidad de minutos más alto)

Costo fijo= 239 - (0.5*269)

Costo fijo= $104.5

Costo fijo= costo total más bajo - (costo unitario*cantidad de minutos más bajo)

Costo fijo= 175 - (0.5*141)

Costo fijo= $104.5

10 x 10= 100
mbnv nmvbnhm
mb cvnmbnbn

Answers

Answer:

well your ans is right over there...

Step-by-step explanation:

thank you!!

Answer:

Yeah...10*10 = 100

so what?

[tex]3x^{2} +9x^{2}-9x+9[/tex]

Answers

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

[tex]3 {x}^{2} + 9 {x}^{2} - 9x + 9 = [/tex]

[tex](3 + 9) {x}^{2} - 9x + 9 = [/tex]

[tex]12 {x}^{2} - 9x + 9 = [/tex]

[tex]3(4 {x}^{2} - 3x + 3) [/tex]

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

Which is a perfect square
72
81
90
99

Answers

Answer:

90

Step-by-step explanation:

90 degree angle is a perfect square

Answer:

B)  81

Step-by-step explanation:

Calculate the variance of the following set of data.

3, 33, 303, 233, 3, 73, 83, 63

Answers

Answer:

its 12084

Step-by-step explanation:

on my test

Variance is the measurement of the spread between numbers in a given set of data.

The variance for the set is 12083.929

What is a variance?

It is the measurement of the spread between numbers in a given set of data.

We have,

3, 33, 303, 233, 3, 73, 83, 63

The formula to find variance:

Find the means of the set of data.

Find the deviation of the set of data from the mean.

Find the sum of the squares of the mean deviations.

Divide the sum of the squares of the mean deviations by (n-1)

where n is the number of data in the set.

The mean:

= (3 + 33 + 303 + 233 + 3 + 73 + 83 + 63) / 8

= 794/8

= 99.25

Deviation from the mean:

3 - 99.25 = -96.25

33 - 99.25 = -66.25

303 - 99.25 = 203.75

3 - 99.24 = -96.25

73 - 99.25 = -26.25

83 - 99.25 = -16.25

63 - 99.25 = -36.25

The sum of the squares of Mean deviation:

= 9264 + 4389 + 41514 + 9264 + 689 + 264 + 1314

= 84587.5

The variance:

= 84587.5 ÷ (8 - 1)

= 84587.5 / 7
= 12083.929

Thus,

The variance for the set is 12083.929

Learn more about variance here:

https://brainly.com/question/13708253

#SPJ2

I don’t understand.

Answers

Answer:

y = -2/3x

Step-by-step explanation:

A perpendicular line is the negative reverse of the slope of the other line. I'm not sure about the options you have there but hopefully this helps you get your answer.

If three quarters of the pizza provided 12 pieces to the table how many pieces were in the pizza when it was full

Answers

Answer:

9

Step-by-step explanation:

Answer:

16 slices of pizza

Step-by-step explanation:

divide 12 by 3

that would give you 4

now add 4 to 12

viola you have the answer of 16

Factoriza la siguiente expresión 25
x2−4

Answers

Answer:

english pls

Step-by-step explanation:

La respuesta es (5x+2)(5x-2) creo
Como hacer lo;
Mira para factorizar esta problema usas;
a^2-b^2=(a+b)(a-b) adonde a=5x y luego b=2
(5x+2)(5x-2)

También disculpa si mi español está mal, hablo más el inglés que el español

Kyle deposited $1200 in a savings account that earns 4.25% simple annual interest. If kyle keep the money in the account for 4 years what is the new balance?

Answers

Answer:

If kyle keeps the money in the account for 4 years, the new balance is $1,417.37.

Step-by-step explanation:

You can use the formula to calculate the future value to find the money in the account after 4 years:

FV=PV*(1+i)^n

FV= future value

PV= present value=$1,200

i= interest rate=4.25%=0.0425

n=number of periods of time=4

FV=1,200*(1+0.0425)^4

FV=1,200*(1.0425)^4

FV=1,417.37

According to this, the answer is that if kyle keeps the money in the account for 4 years, the new balance is $1,417.37.

If m∠FBE=(4x+2)° and m∠EBD=(5x−13)°, then m∠FBA=

Answers

Not enough given information

The Measure of <FBA is 62 degree.

What is Linear Pair?

When two lines cross at one point, a linear pair of angles is created. If the angles follow the intersection of the two lines in a straight line, they are said to be linear. The total of angles of a linear pair is always equal to 180°.

Given:

m∠FBE=(4x+2)° and m∠EBD=(5x−13)°

as, FB bisects <EBA

So, <EBF = <FBA

and,  EB bisects <FBD

So, <FBE= <EBD

4x+ 2 = 5x -13

x= 15

So, <EBF = <FBA = 4x+ 2 = 4(15)+ 2 = 62

Learn more about Linear Pair here:

https://brainly.com/question/17525542

#SPJ2

-2x + 4 < 16
Help me please I didn’t pay attention

Answers

Answer:

I think it’s done like this, I’m not sure

First, collect the like terms

-2x<16-4

-2x<12

x<12/-2

x<-6

So, you substitute -6 instead of x to find which is greater

12+4<16

16<16

Which makes it false

Step-by-step explanation:

I hope I explained well, please give me brainliest

The solution of the inequality - 2x + 4 < 16 will be;

⇒ - 6 < x

What is Inequality?

A relation by which we can compare two or more mathematical expression is called an inequality.

Given that;

The inequality is,

⇒ - 2x + 4 < 16

Now,

Solve the expression as;

⇒ - 2x + 4 < 16

Subtract 4 both side, we get;

⇒ - 2x + 4 - 4 < 16 - 4

⇒ - 2x < 12

Divide by 2 , we get;

⇒ - x < 6

Multiply by - 1, we get;

⇒ x > - 6

⇒ - 6 < x

Thus, The solution of the inequality - 2x + 4 < 16 will be;

⇒ - 6 < x

Learn more about the inequality visit:

https://brainly.com/question/25275758

#SPJ2

A certain shade of paint is made by mixing 8 parts blue paint with 3 parts
white
paint. To get the correct shade, how many quarts of white paint should be mixed
with 64 quarts of blue paint?

Answers

Answer:

15 quarts

Step-by-step explanation:

What is the value of the 5 in the number 2.005?
0.05
0.5
0.005
5

Answers

Answer:

0.005

Step-by-step explanation:

Answer:

.005

Step-by-step explanation:

1) Nyla had 10 songs in a playlist on her phone. The playlist had two of her favorite artists, Beyonce
and Jennifer Lopez. How many of the songs from each artist could she have?
a) Create an equation to represent this situation. Explain what each of the variables represent.
Equation:
b) List at least five solutions to the equation above. How do you know that these are the
solutions to the equation you created?

Answers

Answer:

a) 10 = X + Y

b) X = 1, Y = 9

X = 2, Y = 8

X = 3, Y = 7

X = 4, Y = 6

X = 5, Y = 5

i) The inputted values of X and Y are the solutions of the equation because they sum up to the 10 songs on Nyla's playlist.

Step-by-step explanation:

The given parameters are;

The number of songs in the playlist on her phone = 10

The number of authors of the songs on her playlist = 2

The equation that represent the situation is given as follows;

X + Y = 10

Where X represent the number of Beyonce's song on her playlist and Y represent the number of Jennifer Lopez's song on her playlist

b) 5 possible solutions are;

X = 1, Y = 9

X + Y = 1 + 9 = 10

Which gives 1 Beyonce's and 9 Jennifer Lopez's songs

X = 2, Y = 8

X + Y = 2 + 8 = 10

Which gives 2 Beyonce's and 8 Jennifer Lopez's songs

X = 3, Y = 7

X + Y = 3 + 7 = 10

Which gives 3 Beyonce's and 7 Jennifer Lopez's songs

X = 4, Y = 6

X + Y = 4 + 6 = 10

Which gives 4 Beyonce's and 6 Jennifer Lopez's songs

X = 5, Y = 5

X + Y = 5 + 5 = 10

Which gives 5 Beyonce's and 5 Jennifer Lopez's songs

i) The inputted values of X and Y are the solutions of the equation because they sum up to the 10 songs on Nyla's playlist.

Marcus and Jeremy both evaluated the expression −5^2 + 3. Marcus said the answer was −22. Jeremy said the answer was 28. Who is correct? Explain the error in the other student's work.

Answers

Answer:

Jeremy is correct

Step-by-step explanation:

Marcus and Jeremy both evaluated the expression −5^2 + 3. Marcus said the answer was −22. Jeremy said the answer was 28. Who is correct? Explain the error in the other student's work.

Marcus is wrong

This is because, Marcus calculated:

-5^2 + 3

= -25 + 3

= -22

This is wrong because it did not follow the rules which states that:

- × - = +

Jeremy calculation is shown below:

-5^2 + 3

-5 × -5 + 3

= 25 + 3

= 28

Jeremy is correct

Ada needs to make 140 egg tarts for the wedding. How many eggs should she buy from the store? Remember, her recipe makes 40 egg tarts by using 110 eggs.

Answers

Answer:

Ada should buy 385 eggs from the store.

Step-by-step explanation:

Given that you know that Ada can make 40 egg tarts using 110 eggs, you can use a rule of three to find the amount eggs to make 140 egg tarts:

40 egg tarts    →  110 eggs

140 egg tarts  →         x

x=(140*110)/40=385 eggs

According to this, the answer is that Ada should buy 385 eggs from the store.

5 bananas cost 2.95 how much would 27 bananas cost

Answers

Answer:

78 dollars and 3 cents

Step-by-step explanation: use a calculator

Answer:

15.93

Step-by-step explanation:

each banana costs 0.59 so you multiply 27 times 0.59 = 15.93

Can someone please help me sort them out into True, Not True and Cannot Be Determined

Answers

Answer:

the first, second, and fifth

Step-by-step explanation:

hope this helps :-)

1/3(6x-5)-x = 1/3-2(x+1)
Value of X

Answers

Answer:

x=0

Step-by-step explanation:

do you need work? I did it in my head

Answer:

x=5/24

Step-by-step explanation:

2x-\frac{5}{2}=-2x-\frac{5}{3}  Then add 5/2 to both sides 2x-\frac{5}{2}+\frac{5}{2}=-2x-\frac{5}{3}+\frac{5}{2}  simplify 2x=-2x+\frac{5}{6} add 2x to both sides  2x+2x=-2x+\frac{5}{6}+2x simplify  4x=\frac{5}{6}   divide both sides by 4 \frac{4x}{4}=\frac{\frac{5}{6}}{4} simplify then u get x=5/24

Important phases of Newton's education and scientific work occurred in isolation. Why might this have been helpful to him? On the other hand, why is working in isolation problematic for developing scientific ideas?

Answers

Answer:

Step-by-step explanation:

This might have been helpful to Newton as it allowed him to focus more clearly on his ideas. Newton was incredibly talented and ahead of his time in his field, which being in isolation helped him focus and develop on his ideas. This is not the case for the majority, most scientists tend to focus on a single aspect of a problem, usually the aspect that they have the most experience in. This can lead to them being blinded and not being able to see the possible solution. That is why working with others that are able to view the problem from a different perspective can help greatly.

Working in isolation might have helped Newton focus clearly on his ideas.

Working in isolation might be problematic in developing scientific ideas because of the tendency of having a narrow perspective about a problem and not being able to find possible solution.

What is Working in Isolation?

Working in isolation means to work remotely or alone without the input or help from other people.

Working in isolation might have been helpful to Newton, who was quite talented, as it may have enabled him focus clearly on his ideas.

Why Might Working in Isolation Problematic?

1. Tendency of having a narrow perspective about a problem.

2. Probability of not being able to find possible solution.

In summary, working in isolation might have helped Newton focus clearly on his ideas.

Working in isolation might be problematic in developing scientific ideas because of the tendency of having a narrow perspective about a problem and not being able to find possible solution.

Learn more about working in isolation on:

https://brainly.com/question/7353006

Select all the expressions that can be used to find the price of a $400 telescope after a 32% markup. A)400 • 0.32 B) 400 • 3.2 C)400 • 1.32 D)400 + 400(0.32) E)400 • 400(1.32)

Answers

Answer:

(D) 400 + 400(0.32)

Step-by-step explanation:

We need to find the price of a $400 telescope after a 32% markup.

32% markup means increase in the cost of telescope by 32%. It can be calculated as follows :

[tex]P=400+32\% \ of\ 400\\\\=400+\dfrac{32}{100}\times 400\\\\=400+0.32(400)[/tex]

Hence, the correct expression is option (d).

Answer:

(D) 400 + 400(0.32)

Step-by-step explanation:

We need to find the price of a $400 telescope after a 32% markup.

32% markup means increase in the cost of telescope by 32%. It can be calculated as follows :

Step-by-step explanation:

Caleb and his sister are combining their trading cards. He has 29 cards, and she has 16 cards. They then trade an equal number of cards to 9 friends. How many cards does each friend get?

Answers

Answer:

The answer is 5 cards.

Step-by-step explanation:

Yu have to add 29 and 16 . When yu do that yu get 45 cards total. Divide 45 by 9 (friends) yu get 5 cards per person.

What’s the answer to the question

Answers

Answer:

Slope = -2, y-intercept = 12 (b)

Step-by-step explanation:

Using the slope formula:

slope = change in y (y2-y1) / change in x (x2-x1)

slope = (12-18)/(0+3)

slope = -6/3

slope = -2

The slope is -2

If you look in the table, when x=0, the y value equals 12. This means that the y-intercept = 12, since the y-intercept is when the x equals 0. Thus we have our answer.

Subtract: 3.8 - 2.923. Explain in your own words how you would solve this, in detail, from start to finish.

Answers

Given:

The expression is 3.8 - 2.923.

To find:

The subtraction.

Solution:

We have,

[tex]3.8-2.923[/tex]

It can be written as

[tex]3.800-2.923[/tex]

Now,

3 . 8 0 0

-2 . 9 2 3

-----------------

0 . 8 8 7

-----------------

So, [tex]3.800-2.923=0.887[/tex]

Therefore, the value of [tex]3.800-2.923[/tex] is 0.887.

Other Questions
Question 8 (1 point)Choose the correct form of the verb in the preterite. 1. Yo _________ (organizar) bien las cosas en la maleta. aorganiz borganizaste corganiz dorganic Please select the word from the list that best fits the definitionDoctors appointment today at 3:20pma.term calendarsb. weekly schedulec. daily organizer hellpppppp please I will give brainliest DUE 10:00 PM HELP ASAP. When Sarah left your house this morning her cell phone was 80% charged and then it started to lose 8% charge for each hour there after write an equation for B in terms of tea representing the charge remaining in series battery as percentage t hours after Sara left her house A news report says that 9% of middle school students are on the track team. There are 600 students in your middle school How many students in your school would you expect to be on the track team? HE Pad SATTE BAR HG West nus SAUNA w 1 PLEASE HELP! THIS A TIMED QUIZ!!Scientists found an artifact that has 25% of Carbon-14 left. Based on how much Carbon-14 is remaining, how old is the artifact that was found?A). 17,100 yearsB). 5,700 yearsC). 22,800 yearsD). 11,400 years Please help asap! Ill give brainliest!What theme does the excerpt convey?It is right to be wary of the unknown.Pride interferes with progress.Manners must be displayed in all situations.Strange animals cannot be trusted. What is your response? Why do u think sunny asks so many questions? anyone out there an expert on dreams?? Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105