GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

GTA: TAA MRNA UCA : CAU: AUU TRNA AGU : GUA : UAA RRNA Serine Valine Stop You Need To Solve The Entire

Answers

Answer 1

Answer:

u want step by step?

Explanation:


Related Questions

7. In a cross with a homo zygous, grey, female moth and a homo zygous, black, male moth, all of the progeny are grey. In a cross with a homo zygous, black, female moth and a homo zygous, grey, male moth, all of the progeny are black. What is the best explanation for this? (2 words)

Answers

Answer:

Due to dominant trait.

Explanation:

The best explanation for this result is that grey colour is dominant trait due to which all of the progeny appears grey while in the second example, black colour is dominant trait which appears in the all the offspring of moth. In the offspring, only that trait becomes visible which is dominant while the trait which does not appear is known as recessive trait so that's the reason due to which grey in the first and black colour in the second becomes visible.

The giant african land snail is an invasive species that is also the largest snail ons earth what is most likely consequence of introducing this invasive species into a stable ecosystem?

A. The native snail species will change their diet therefore destabilizing the ecosystem.

B. The native snail species will move to another area allowing the ecosystem to remain stable.

C. The native snail species will share their food with the invasive species stabilizing the ecosystem.

D. The native snail species will compete for resources with the invasive species and destabilize the ecosystem ​

Answers

Answer:

D. The native snail species will compete for resources with the invasive species and destabilize the ecosystem ​

Explanation:

In Ecology, an invasive species refers to a species of organism that is foreign i.e. non-native to a particular habitat or environment. They are characterized by the ability to proliferate in growth and compete for space and nutrients with the native species in the habitat they are introduced to.

In this case, the giant african land snail, which is an invasive species, if introduced into a stable ecosystem will compete for resources with the native species of that ecosystem leading to the destabilization of the ecosystem.

An incoming ray of light strikes the surface of a calm pool of water. Which letter below indicates the
reflected ray of light?

Answers

If I'm correct its W ....

When will a seed begin to germinate?

A. When it has sunlight and water

B. When it has energy

C. When it has water

D. When it has sunlight

Answers

Answer:

A

Explanation:

When it has sunlight and water

Answer:

A. When it has sunlight and water

Explanation:

What formed between Australia and Antartica? What was the result of this?

Answers

The answer is Gondwana Australia and Antarctica were once part of the same land mass which is a supercontinent known as Gondwana :) Pls mark as brainliest

Write a paragraph describing the function of the endomembrane system? Include these terms: DNA, RNA, Ribosome, Endoplasmic Reticulum, Golgi Apparatus, plasma membrane, secretory vesicle, free ribosome, bound ribosome, protein.

Answers

Answer:

Please find the function of the endomembrane system below.

Explanation:

The endomembrane system is a system of membranous organelles in eukaryotic cells which plays the collective role of synthesis, modification, packaging and transportation of lipids and proteins within the cell. The organelles involved are endoplasmic reticulum, Golgi apparatus, vesicles and plasma membrane.

DNA, which is the genetic material in living cells encodes genetic information. The information in DNA is transcribed in the nucleus into a RNA molecule, which is then translated in the ribosomes (organelle for protein synthesis) into PROTEINS. Ribosomes can either be free or membrane-bound depending on whether it produces proteins that are used in the cell or are exported out of the cell respectively. However, ribosomes are attached to the surfaces of endoplasmic reticulum making them called ROUGH ENDOPLASMIC RETICULUM. This makes rough endoplasmic reticulum associated with protein production/synthesis.

The synthesized proteins is then packaged and modified in the GOLGI APPARATUS, after which it is transported by SECRETORY VESICLES that transports it to the PLASMA MEMBRANE for exocytosis.

1. True or False? Climate Change refers to major and long-term changes in the average state;
temperature, precipitation, wind patterns, etc. of the Earth's climate.

Answers

Answer:

True

Explanation:

Climate change is a long-term shift in global or regional climate patterns. Often climate change refers specifically to the rise in global temperatures from ... from the sun's rays inside the atmosphere causing Earth's average temperature to rise. ... Throughout Earth's history, climate has continually changed.

1. precipitation

2. weather

3. temperature

4. windward

5. El Niño

6. The Antarctic Circumpolar Current transports warm water from the Pacific Ocean to the northern Atlantic Ocean. This warms the Atlantic Ocean and increases temperatures in the surrounding region. This reduces seasonal fluctuations in European weather patterns. also

I believe the statement that best compares weather and climate is that Weather refers to the atmospheric conditions at a given time while climate refers to the average weather conditions over an extended period of time. Weather reflects short term conditions of the atmosphere while climate is the average daily weather for an extended period of time at a certain location.





Advances in technology have helped many industries, including agriculture. Which agricultural application is most likely

to be affected by new advances in DNA technology from the Human Genome Project?

O a researcher who is investigating selective breeding of livestock

O a farmer who is planning a harvest schedule for genetically modified crops

O a plant scientist who is modifying the genetic information of crop plants in a laboratory

O a conservationist who wants to find water sources in drought-prone places

Answers

Answer:

O a researcher who is investigating selective breeding of livestock

Explanation:

The Human Genome Project (HGP) aims at determining the full nucleotide sequence of the human genome, which can be used for the identification, characterization and mapping of the human genes. The livestock genome sequence exhibits a high level of conservation with the genomes of many mammals including humans. In consequence, the information obtained by mapping genes from the HGP can be of help to map livestock genes. The livestock genome mapping projects have greatly been helped by the increasing availability of human and murine genome sequences, which has been used in comparative genomics for the identification of candidate genes involved in animal traits.

Answer:

A

Explanation:

Can someone help me asappp

Answers

Answer:

im 90% sure its D

Explanation:

well

I think it’s D sir it’s easy

When fungi and bacteria decompose organic matter, they return ____ to the environment.

Answers

Answer:

Carbon and nitrogen.

probably

Hope that helped :)

Fungi and bacteria decompose organic matter, contributing to the formation of soil organic matter since they return nitrogen and carbon to the environment.

How is the decomposition of organic matter?

Fungi and bacteria break down residues and organic matter, excess nutrients (nitrogen, phosphorus and carbon) are released into the soil in forms that can be used by plants (nutrient availability).

The nitrogen released by these microorganisms is in the form of ammonium (NH4+) and thus readily available to the roots of plants and other organisms.

By decomposing residues and storing carbon within their own biomass, soil biota play a very important role in nutrient recycling processes.

Therefore, we can conclude that the most important function of fungi and bacteria microorganisms is the breakdown of organic materials.

Learn more about the decomposition of organic matter here: https://brainly.com/question/6183920

*
Replication can best be described as:
1.making new DNA using the old DNA
2.making RNA using DNA
3.making proteins using RNA
4.making proteins using DNA

Answers

Answer:

2

Explanation:

DNA splits to make RNA

2 making RNA using DNA

Which component of the biosphere is an example of organic matter?
A. Phosphorus
B. Glucose
C. Carbon dioxide
D. Oxygen

Answers

pretty sure it’s glucose i could b wrong tho
b :) hope this helps

I have a Lab work who will do it for me I'll give 100 points

promise

Answers

Answer:

Okay, what is it?

Explanation:

If a strand of DNA has 24% T, what percent will be G?

Answers

If one strand of DNA has 24% T, it would have 26% G.

Answer:

points

Explanation:

for freee thanks and sorry

2) Fill in the blanks with the following options.
What was the environment of early earth like? Complete the statement below to answer the question.

a)wind
b)elements
c)gases
d)inorganic
e)organic
f)lightning
g)primordial

______seas absorbed______of the atmosphere, there was a heavy concentration of ultraviolet radiation from the sun, and frequent______strikes, and the environment was helpful in producing______molecules from______molecules.

Answers

Answer:

1.primordeal 2.gases 3. lightning 4.organic 5.inorganic

PRIMORDEAL seas absorbed GASES of the atmosphere,There  was a heavy concentration of ultraviolet radiation from the sun, and frequent LIGHTNING strikes, and the environment was helpful in producing ORGANIC molecules from INORGANIC  molecules.

Gases are absorbed by the primordial seas and lightning strikes in earth helpful in producing inorganic molecules from  organic molecules  mostly present in living things.

What is primordial sea?

Oceans of earth in the earlier time is called as primordial seas in the history . Primordial seas creates heavy rain last for long time.

Lightening in earth is caused by electrostatic charge from the ions in the atmosphere. Lightening is followed by thunder. Lightning helps to produce oxides and nitrogen in the atmosphere.

The passage which describes the weather in the earth can be completed as follows:

Primordial seas absorbed gases of the atmosphere, there was a heavy concentration of ultraviolet radiation from the sun, and frequent lightning strikes, and the environment was helpful in producing inorganic molecules from organic molecules.

To find more on lightning, refer here:

https://brainly.com/question/10443677

#SPJ2

Where is blood produced?

Answers

Blood is produced In the bone

Answer:Love..

Explanation:

Love comes from your....

how do central nervous system and the peripheral nervous system work together to control the body?

Answers

The central nervous system includes the brain and spinal cord, while the peripheral nervous system includes all of the nerves that branch out from the brain and spinal cord and extend to other parts of the body including muscles and organs. Each part of the system plays a vital role in how information is communicated throughout the body.

The primary role of the PNS is to connect the CNS to the organs, limbs, and skin. These nerves extend from the central nervous system to the outermost areas of the body.

In conjunction with the central nervous system (CNS), the PNS coordinates action and responses by sending signals from one part of the body to another.

The general flow of information is that the peripheral nervous system (PNS) takes in information through sensory neurons, then sends it to the central nervous system (CNS) to be processed. After processing, the CNS “tells” the PNS what to do—what muscles to flex, whether the lungs need more oxygen, which limbs need more blood, any number of biological processes—and the PNS makes it happen through muscle control. The neurons responsible for taking information to the CNS are known as afferent neurons, while the neurons that carry the responses from the CNS to the PNS are known as efferent neurons.

Which has become the greatest source of environmental change a) acid rain b) energy c) conservation d) human activity

Answers

Answer:

human activity, i think.

Answer:

human activity

Explanation:

Humans can build things acid rain and the others cant,Human Activity has changed most of everything

Select the correct answer from the drop-down menu. The lunar eclipse occurs during the _______ phase. A.new Moon B.full Moon C.first-quarter Moon D.last-quarter Moon​

Answers

Answer:

B. full moon

Explanation:

A solar eclipse occurs in the daytime at new moon, when the Moon is between Earth and the Sun, while a lunar eclipse occurs at night at full moon, when Earth passes between the Sun and the Moon.

Can I get Brainliest? TYSMMMMMMMMMMMMMMM

Answer:

the correct answer is . B

Explanation:

How has the environment of this location changed since Basilosaurus lived?

Answers

The fossil shown in this photo is of a Basilosaurus. Its skeletal features suggest that it spent its entire life swimming in the ocean. Look at the environment the fossil was found in. Consider that Basilosaurus lived in the ocean

The geologic species scale has units based on changes in rocks and fossils.
True
False

Answers

Well I’m not for sure but I think it’s false because the units can be Baer in animals too

The geological time scale/species scale is divided into different units of time depending on changes in the rocks and fossils. So the statement is true.

What is the geological time scale?

The lengthy period of time that the Earth's geologic history has taken up is known as geologic time. Starting at the beginning of the Archean Eon (4.0 to 2.5 billion years ago), formal geologic time runs to the present.

The Hadean Eon, an informal time period that runs from around 4.6 billion years ago (corresponding to Earth's first creation) to 4.0 billion years ago, is also frequently included in modern geologic time scales. The period of Earth's history that is reflected by and preserved in the planet's rock layers is known as geologic time.

Events throughout Earth's history are "calendared" according to the geologic time scale. It divides all of the time into named units of abstract time known as eons, eras, periods, epochs, and ages, in declining order of duration. Those geologic time units are counted according to stratigraphy, the correlation, and the categorization of rock layers.

Therefore, the geological time scale is used for dividing different units of time according to changes in rocks and fossils. Hence the statement is true.

Read more about geological scale, here

https://brainly.com/question/10662464

#SPJ2

SOS SOS SOS SOS WILL MARK BRAINLIEST Which statement correctly connects the bee-eater's adaptations with its environment?


The environment determines which bee-eater traits are adaptive.

The bee-eater's traits influence where it chooses to live.

I narrowed it down to these 2 answers. help me xddd

Answers

Answer:A/ the top one

Explanation:

because it’s talking about how they adapt not how they get to the point where they adapt.

The environment determines which bee eater traits are adaptive.

If certain traits of the organism help them in the environment, then that trait can be considered adaptive. They are considered adaptive or not based on its interaction with the environment.

"What would railroads do if every state had different requirements for smokestacks or track width?"

Answers

Answer:

The train will move on the roads.

Explanation:

If every state had different requirements for smokestacks or track width, the trains should be run on the roads because if there is different requirement for track width, it is impossible to run same type of train on these tracks. One another act will be done and that was to make different types of trains for each state so that they can move on the tracks. But it is impossible for having different track width, it must be of same width.

As the fruit develops, why do the petals, stamen, and sepals fall off?
A. The fruit absorbs them, which gives the fruit its color.
B. They have served their purpose and are no longer needed by the plant.
C. The material in the petals, stamen, and sepals become the skin of the fruit.
D. The flower has become dehydrated.

Answers

Answer:

A. The fruit absorb them, which gives the fruit its color

Explanation:

basta yunn

A, the fruit absorbs them.

hurry plz due in five min

Answers

Answer:

Its B the 2nd option

Explanation:

.......

HELP PLEASE ILL GIVE BRAINLIEST!!!

Answers

Answer:answer is osmosis

Explanation:

im smart

two liquids that are at two different temperatures are added to each other in a container is closed . The temperature is taken at one-minute intervals .

Answers

Answer: Graph A

Explanation:

Which 3 characteristics did Darwin observe that were slightly different in a population?
A function, breeding habits, food sources
B form, function, behavior
C behavior, form, food sources
D form, breeding habits, behavior

Answers

Answer:

B. form, function, behavior

Explanation:


5. Why are microscopes useful tools in biology?

Answers

Answer:

cause to see the small organism that are only seen by microscope

When you exhale, what happens in the lungs?
A. Air moves from high pressure (in the lungs) to low pressure (outside)
B. Space in the lungs increases
C. Lung pressure decreases
D. Air moves from low pressure (in the lungs) to high pressure (outside)

Answers

Answer:

Conversely, exhalation moves the diaphragm up into the chest cavity and reduces the space in it. This forces the air, which is dense with carbon dioxide at that point, out of the lungs and windpipe. It then exits the body either through the nose or mouth. Usually, this requires no physical effort from the body.

Explanation:

So its A

Other Questions
From Smallest to Largest Moonasteroid meteorite meteoroid Julio says, "If you subtract 13 from my number and multiply the difference by -3, the result is -54 ." What is Julios's number? You are driving on the highway at a speed of 40 m/s (which is over the speed limit) when you notice a cop in front of you. To avoid a ticket, you press on the brake and slow to a speed of 30 m/s over the course of 5 seconds. What is the acceleration of the car? WORK=BRAINLIESTWhat is your car's initial velocity? What is your car's final velocity? How long does it take the car to slow down? Write the equation you will use to solve this problem. What is the acceleration of your vehicle? + 2.0 m/s^2- 2.0 m/s^2+ 8.0 m/s^2- 6.0 m/s^2 Geralds manufacturing firm sold goods worth $6000 to some customers on credit in the month of January. His customers plan to pay him the entire amount at once in March. Gerald plans to record and recognize this income in the businesss accounts in March. Which accounting method does Geralds business follow?His business follows the (________) method of accounting. Solve 8,961 29 Using standard algorithm.(Giving brainliest and extra points) In the following sentence, what change, if any, should be made to correct capitalization?My favorite Season is spring because the flowers are always so pretty and the bluebirds sing. The product of 900 and 200 expressed in scientific notation is Which inequality is equivalent to -y> 18 Pulling out from the wall a folding-bed, Jimmy slid back a panel in the wall and dragged out a dust-covered suit-case. He opened this and gazed fondly at the finest set of burglar's tools in the East... ...In half an hour Jimmy went down stairs and through the cafe. He was now dressed in tasteful and well-fitting clothes, and carried his dusted and cleaned suit-case in his hand. "Got anything on?" asked Mike Dolan, genially. "Me?" said Jimmy, in a puzzled tone. "I don't understand. I'm representing the New York Amalgamated Short Snap Biscuit Cracker and Frazzled Wheat Company." What does this selection suggest Jimmy's next step will be? Should citizens or the government have more power? What rights should all citizens have? What responsibilities should all citizens undertake to make sure their government runs effectively? Qu te gusta ms, escuchar msica ____ leer? Please help with this math question guys! Thank you! (Please choose one of the provided answers)I will mark Brainliest :) PLEASE HELP Rpondez avec une expression ngative.1. Tu attends quelqu'un?2. Il mange encore?3. Vous prenez quelque chose?4. Tu regardes toujours la tl?5. Les enfants font la lessive ou la vaisselle? (Laundry /dishes)6. Nous prparons encore le dner?7. Tu attends quelque fois tes copains aprs les cours?8. Simone achte une jupe et un chemisier?9. Elles vont mercredi aprs-midi?10. Nous allons faire tout?11. Tu vas aller la piscine ou la plage?12. Grard invite tout le monde?13. lise coute la prof?14. Tout va bien? A local specialty store sells two brands of yogurt. Brand A is a fruit yogurt that comes in a 12-ounce container for $2.88. Brand B is a fruit yogurt that comes in a 16-ounce container for $4.48. Which one is a better buy: Brand A or Brand B? Which of the following phrases best describes Vonnegut's attitude towards his books being burned ? can someone help me please Give the slope between the points(-2,3) (-5, -9) 8. Which type of element requires the least amount of energy to remove an electron? Translate the sentence six less than the product of four and a number is -2 into an equation Calculate the volume in milliliters of 1.57 M potassium hydroxide that contains 10.3 g of solute.