heres something else i wrote lol its not hw

Heres Something Else I Wrote Lol Its Not Hw

Answers

Answer 1

oooooooooooooooooooooooo cool

Explanation:

Answer 2

Answer:

Good writing

Explanation:

hits deep


Related Questions

5. Which chapter title provides the best hint about the main idea of the chapter?
Friends and Family
Don't Think About It
In the Last Second
ОО
A Police Officer's Day

Answers

Answer:

A Police Officer's Day

Explanation:

it was on my test

The title of the chapter that provides the best hint about the main idea of the chapter is (A) Friends and Family.

What do you mean by 'main idea' of the chapter?

The main idea of the chapter refers to the main theme around which the plot of a chapter revolves. It reflects what the chapter wants to tell us about. It also emphasises on the main point on which the chapter focusses on.

Out of the given options, Option (A) clearly reflects the main idea about the chapter.

Therefore, the chapter title provides the best hint about the main idea of the chapter is (A) Friends and Family.

Learn more about 'main idea' on https://brainly.com/question/1119015

#SPJ2

What lesson did you learn from the Emancipation Proclamation?

Answers

Answer:

Lesson Summary

The Emancipation Proclamation was an important first step in ending slavery, the practice of stripping African Americans of their freedom by forcing them to work without pay, throughout the country and a big victory for abolitionists (people against slavery) and freed slaves.

Compare Professor McGonagall to Hagrid. How are they different? How are they alike?

Answers

Answer:

Professor McGonagall and Hagrid both teach at Hogwarts.

Explanation:

Answer:

they are both in the order

hagrid got expelled

Explanation:

What does Aries ask Percy to get for him

Answers

Answer:

he left his shield in the Tunnel of Love ride at a local water park. He needs percy to get it for him, as a way of proving themselves to him.

Explanation:

I think

Which sentence correctly punctuates a nonessential appositive phrase?
O Aries, one of thirteen constellations in the Zodiac, contains four stars.
O Aries one of thirteen constellations in the Zodiac contains four stars.
O Aries, one of thirteen constellations, in the Zodiac contains four stars.
O Aries one of thirteen constellations in the Zodiac, contains four stars.

Answers

Answer:

the first one

Explanation:

Aries, (pause) one of thirteen constellations in the zodiac, (pause) contains four stars.

Answer:

Its A

Explanation:

I got it right on the exAM!!1

what is the denotation of a word? A. it’s etymology.
B. it’s part of a speech.
C. it’s literal, dictionary definition.
D. it’s extra, implied meaning.

Answers

Answer:

c. its literal, dictionary definition

Explanation:

denotation- the literal or primary meaning of a word, in contrast to the feelings or ideas that the word suggests.

Answer:

The answer is C.

Explanation:

Research what institutions in your community which helps the people suffering from mental illness. Write the programs they offer and the benefits the patients can get.

Please help me..

Answers

Answer and Explanation:

My community is very small and therefore does not have many institutions dedicated to mental health care. However, as this is a very serious and important issue, a program of psychological and psychiatric care provided by the city has been established and which is entirely free. for the population that needs it. The benefits of this program are that it allows people who cannot afford to have access to psychological treatment when they need it.

In addition to offering psychological and psychiatric treatment, the program offers lectures explaining how important and fragile mental health is, in addition, the program has a life support phone line, where people who are having dangerous thoughts can call and receive advice of professionals.

List 20 things ur grateful for

Answers

Answer:

my family

a house

friends

toys

my dog

my bed

food

clothes

And everything

i have that others arent able tk bave

Answer:

my health, my kids, my job, my family, friends, home, for God, Jesus, love, hubby, car, clothes, my mom, my dad, my aunt, grandmother, cousins, nephew's, nieces

During a group discussion of William Shakespeare’s play Romeo and Juliet, Javier confidently reads aloud a preselected scene. He then adds other facts about the play and offers his opinions. When another student begins to offer another viewpoint, Javier quickly interrupts and restates his facts and opinions. Javier does the same thing when another student attempts to share her ideas.

What statement best describes Javier’s behavior in this discussion?

Answers

The statement that best describes Javier’s behavior in this discussion is: He is well prepared, but needs to follow the rules of the discussion.

In this description of Javier's behavior during the discussion, we find that he is well prepared for the discussion.

However, he needs to apply the spirit of teamwork by giving room to others to air their opinions on the matters being discussed.

So, option A correctly describes Javier's behavior in this discussion.

Learn more about group discussion here:

https://brainly.com/question/2290843

Answer:

A

Explanation:

HELP ASAPPPP!!!!!
I1. Which sentence below from Passage 1 BEST supports the claim that "animal testing is the best way of
deciding whether products are safe for humans?"
A "Outlawing animal testing would result in humans dying in medical trials."
B
"Because animals lives are shorter, long-term side effects appear much sooner."
"If we used humans for these, research could take more than 200 years, while with mice, it
can take less than 10 years."
D
"Alternative methods of testing are either unethical or give suspect results at best."

Answers

Answer:

C would be the best answer, as it gives reason while still remaining ethical.

What is the best reason for including paragraphs 1 through 12 in this piece?(Will give brainliest)


A.They provide historical context for the argument.


B.They provide ethos, logos, and pathos to the central argument.


C.They encourage the reader to question the authors’ premise.


D.They establish the primary rebuttal of the authors’ argument.


E.They outline the chronology of the events, allowing the authors to reference them to support their main argument.

(piece bellow)
https://www.bartleby.com/71/1304.html

Answers

Answer:

Prety sure it is A because the other choices dont make sense

Explanation:

Answer:

I was thinking A or B. Does anyone know what the right answer was?

Explanation:

Ill give brainly

I dont even know which subject this goes in lol

Answers

Answer:

think you got the right one

Explanation:

pls brainliest

Answer:

could be Business

Explanation:

To blank
is to derive a conclusion by reasoning.

Answers

Answer:

deduce or infer.

Explanation:

To arrive at by reasoning; deduce or infer. Derive a conclusion from facts. ... (logic) To deduce (a conclusion) by reasoning.

Why did Mrs. Wright's cherry preserves freeze

Answers

Answer:

Because nobody lit a fire over night, the kitchen got so cold that the jars froze  preserves have shattered, and they mention that Mrs. Wright is worried about them.

Explanation:

"Nothing. Only I haven't a dress and so I can't go to this party. Give your invitation to some friend of yours whose wife will equipped better than I shall."

Answers

Answer:

This is an excerpt from the short story "The Necklace" written by Guy de Maupassant and portrays the moment when Mathilde is saddened by her economic condition.

Explanation:

Mathilde is a married woman who lives an economically stable life, but without many luxuries, since her husband's work manages to pay a friendly life, but without wealth. She hates this situation, because she wanted to be a woman of many jewels and extravagant things like her friend, who she dies of envy.

The above excerpt shows the moment when Mathilde's husband gets an invitation to a very important dinner and is excited to take her out for fun, but Mathilde is very disappointed because she doesn't have a new dress to wear, her husband is left with sorry for her and makes an effort so she can buy the dress.

A generally appears before a list.

Answers

What do you mean??

is this the question or just a statement

Determine two character traits for one of the main characters in your book ( auggie ). Give TWO QUOTES from your book to support each trait. Be sure to include the page number! PLEASE HELP ME!!! MY BOOK IS WONDER!!

Answers

Answer:

When given the choice between being right or being kind choose kind.”

I think there should be a rule that everyone in the world should get a standing ovation at least once in their lives.

Explanation:

Here, I made a doc. I hope this helps. I would appreciate it if you marked me brainliest!

Page numbers are 167 and 14.

One thing. For the first quote, you will need to change some of the words because they spell it wrong in the book because they are emails. For example, I wrote "friends" but in the book its frenz.

What is the Prince going to do to the next person who brawls? ( Romeo and Juliet ) PLEASE HELP

put him in the stocks
put him in exile
put him in the dungeon
put him to death

Answers

Answer:

put him to death. hope this helps

Put him to death

ಠ_ಠ

Have a Blessed day!

Most students have difficulty in deciding what to study after high
school. Did you also have that problem? Work in a group of three and
share the dilemma you had and how you decided to study the subject
that you have chosen.​

Answers

Answer:

I did not experience trouble deciding what fields to study in after high school.

Explanation:

Having known that I have always been a very kinesthetic learner, and since it was apparent that I enjoyed a fluctuation in my day-to-day activities, I have known that I wanted to study gastroenterology. This profession not only allows me to provide a helping hand to the world around me, but I may also experience new things every single day. The paycheck also persuaded me...just a little.

Which thesis is stronger? Explain your answer using complete sentences.


A) Globalization has created many new jobs in India.
B) Globalization has had a positive effect on India because it offers new solutions to poverty.

Answers

Answer:

B

Explanation: Because A doesn’t give enough information

Subject and predicate: This dictionary has a red cover

Answers

Answer:

Subject: This dictionary

Predicate: has a red cover

Explanation:

It is not important to determine which verb is proper to use in different sentences.

True
False

Answers

Answer:

true

Explanation:

 

Answer: false

Explanation: If your sentence is in past tense, a present tense verb will not suit the sentence.

For example:

Sam run to the store. - improper verb tense

Sam ran to the store. - proper verb tense

Hope it helps!

Normal or regular syntax follows which pattern? Group of answer choices: 1 beginning, middle, end 2 verb, subject, object 3 subject, verb, object 4 article, subject, verb

Answers

Answer:

3. Subject, verb, object.

Explanation:

To complete this exercise, you have to select the correct answer for the question about syntax's pattern.

The most common syntax follows the pattern "subject, verb, object", the third option, so that means that in a sentence the subject comes first, then the verb and finally the object. For example: Thomas enjoys parties.

Thomas (subject)

Enjoys (verb)

Parties (object)

1. How do you express yourself? 2. How do you see yourself? 3. How much do you know yourself? 4. How much do others know you?

Answers

1) through clothes 2) kind and caring yet mysterious 3) enough but there is always room for improvment 4) as much as theyd like i suppose. to each their own

Study the cartoon Bubble Sheets, by Greg Kearney. 2 children are holding test sheets and a sign behind them reads "Today's test schedule." One child says "I am ready to live in a world where we fill in bubble sheets, lots of them." What evidence supports the cartoonist’s perspective about testing? The students have no expressions on their faces, showing that they are not happy about the tests. The exams are huge and are labeled "more tests" and "still more tests," showing that testing is overdone. The student's response to testing is that he is prepared for it, showing that testing works well. The children are paying attention to the test schedule, showing that students are

Answers

Answer:

B. The exams are huge and are labeled “more tests” and “still more tests,” showing that testing is overdone.

Explanation:

correct on edge 2020

The exams are huge and are labeled "more tests" and "still more tests," showing that testing is overdone.

Evaluate Reread lines 94–108. Is Kielburger’s statement about “the heart of a street child” valid? Why do you think that?

Answers

Answer:

yes because he saw over & over again how generous poor street children are

Explanation:

school

Kielburger’s statement about “the heart of a street child” is valid because he saw how generous were the street child, and if everyone could have heart of a street child, no children would be alone in the streets.

Who was Kielburger?

Craig Kielburger is a human right activist and social entrepreneur. He is the co-founder of WE charity with his brother from Canada.

His foundation helps in lifting people below poverty line from Asia, Africa, and America. The foundation helped more than 1 million people so far.

Thus, Kielburger’s statement about “the heart of a street child” is valid because he saw how generous were the street child, and if everyone could have heart of a street child, no children would be alone in the streets.

Learn more about Craig Kielburger

https://brainly.com/question/15159806

#SPJ2

How does each poet use word choice to create tone and imagery

Answers

Answer:

The answer is Lowell uses concrete language. Lowell focuses on the image of birds and changing seasons. Longfellow uses both concrete and abstract language. Longfellow uses many images. Longfellow's speaker addresses "us," creating an abstract, preachy tone. Lowell uses "I,"creating a personal tone.

Which subject and verb are in agreement? Select one: my parents/goes. children/plays. San Francisco Giants/have. Parents and children/is.

Answers

Answer:

San Francisco Giants/have

Explanation:

The text is Advice To The Newly Married Lady.

What is the author’s purpose for writing this text?

A. to compare the life of a woman to that of a man

B. to describe the perfect marriage and provide instructive examples

C. to persuade women it is in their best interest to have a happy marriage

D. to list the duties of a wife so that men know what to expect from marriage

What’s the answer?

Answers

Answer:

D

Explanation:

It is

The author's purpose for creating the given excerpt would be as follows:

C). to persuade women it is in their best interest to have a happy marriage.

The purpose that the author wishes to serve through the given text would be to convince the women that having a successful marriage is most suitable source of happiness for them. In order to successfully accomplish this purpose, the author uses various descriptive words 'securing marriage...happiest,' 'much better...thoughts,' etc.These details substantiate the author's attempt to persuade the women that happy marriage ensures the gateway of a better life.

Thus, option C is the correct answer.

Learn more about 'Author's Purpose' here:

brainly.com/question/15472813

Read the excerpt from a student’s essay.

The first mention of Ship-Trap Island already gives the reader an uneasy feeling. Whitney describes the island’s fearsome reputation among the ship’s crew as Rainsford peers into the black night to see any sign of the place. He cannot see the mysterious island, and Whitney knows little about it, other than that it frightens the sailors. Interestingly, it fills Whitney with a sense of dread as well.

Which revision of the first sentence best incorporates the literary term mood?

Rainsford is not in the mood to listen to Whitney’s irrational assumptions about Ship-Trap Island.
Whitney and Rainsford’s discussion of Ship-Trap Island immediately establishes a foreboding mood.
Whitney’s description of Ship-Trap Island instantly puts the reader into the right mood to read the story.
The story’s overall tone is established by the moods of its characters, Whitney and Rainsford.

Answers

Answer: Whitney and Rainsford’s discussion of Ship-Trap Island immediately establishes a foreboding mood.

Explanation: In literature, the mood is a literary element that makes the reader feel certain feelings or vibes through words and descriptions. It can also be described as the atmosphere of a story or a text, it is basically the emotional setting of the story. In the given excerpt from a student's essay about "The Most Dangerous Game" the revision that best incorporates the term "mood" in a literary context is "Whitney and Rainsford’s discussion of Ship-Trap Island immediately establishes a foreboding mood" because it is describing the atmosphere.

Answer:

b

Explanation:

Other Questions
Please need help Choose the words that complete the following sentence.Direct quotes needaround them, or else it is considered(1 point)O quotation marks/summarizingO quotation marks/plagiarismO parentheses/summarizingO parentheses/plagiarism I love you. You are worth it. What does this quote mean? Thanks! Ayala is making salad dressing. She mixes oil andvinegar in a blender until a smooth consistency isformed. Explain whether this is a heterogeneous or ahomogeneous mixture and why. Help?Jessica must determine how many packages of cookies and cupcakes to buy for her family reunion. Jessica's mother has asked her to buy the same number of each type of item but no more than 100 of each. At the bakery, Jessica finds that cookies are sold in packages of 12 and cupcakes are sold in packages of 9.Use the drop-down menus to select the answers that make each statement true.The greatest number of packages that Jessica can buy is _ packages of cookies and _ packages of cupcakes. explain what happens when particles collide When a story is told from the _____, the narrator has full knowledge of all the characters. omniscient third-person point of view reliable first-person point of view unreliable first-person point of view limited third-person point of view The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut a student performed an experiment, using a cocktail peanut, before it was burned the peanut half weighed .353 g. After burning the residue weighed .016 g. The energy released by the conjunction increased the temperature of 200. mL of water in the calorimeter by 7.2 degrees Celsius. Calculate the mass of peanut consumed in the combustion. twice the sum of k and 9 is 4 The product of a number and -5 is at least 35. Write as an inequality. who killed the district judge during the revolutionary movementanswer in one sentence Quick question for you all People who complain that video games involve too much sitting are probably old. They probably dont know very much about gaming, either. They dont realize that people can play virtual sports, such as tennis, on video games. There are video games for dancing, too. If people bothered to learn about the different kinds of video games, they would see how wrong they are. This students sample paragraph addresses the counterclaim. Critique this paragraph by answering the questions.What is the counterclaim?Video games are too violent.Video games make people inactive.Video games are different today.What evidence weakens the counterclaim?People who complain are old.Sitting too much is bad for people.There are video games for sports and dancing.What is the tone of the rebuttal?respectfulrudehumorous Mention the type of seeds that undergo hypogeal germination.What do we call the process of permanently stopping babies from breast feeding?plzz help it is due today 2) look closely at article XLVII. Rephrase it in your own words. How do you think this impacted the unity among slaves during the revolution?Please I need help! Use the interactive tool to graph the line given the following information: coordinates (1,3) slope of 2Based on your investigation, what is the value of b for the point (0,b)? what is carbogen and it's uses