I need help with my spanish


Can someone pls help

I Need Help With My SpanishCan Someone Pls Help

Answers

Answer 1

Answer:

1.comer

2.llegar

3.comer

4.usar

5. comer

6.beber

7.salir

Explanation:


Related Questions

Completa la oración con el Imperfecto del verbo entre paréntesis.
1. Antes de casarse mi padre
(ser) actor
2. Amelia y Tina
(buscar) un apartamento cerca del centro.
3. Tu
(dormir) hasta mediodía todos los sábados, ¿verdad?
4. Antes de estudiar espanol, yo no
(poder) entender lo que
(decir) mis vecinos cubanos.
5. Los viernes nosotros
(preparar) tapas para comer mientras
(mirar) una película
(caminar).
6. Uds, no
(ir) a la escuela en autobús. Uds.
7. A menudo en la playa
(hacer) fresco de noche y
8. Mi tía Luisa, la viuda, siempre
(vestirse) de negro
(haber) una brisa ligera (light breeze).

Answers

Answer:

1. Antes de casarse mi padre era actor.

2. Amelia y Tina buscaban un apartamento cerca del centro.

3. Tu dormías hasta medio día todos los sábados ¿verdad?

4. Antes de estudiar español, yo no podía entender lo que decían mis vecinos cubanos.

5. Los viernes nosotros preparábamos tapas para comer mientras mirábamos una película.

6. Ustedes no iban a la escuela en autobús.

7. A menudo en la playa hacía fresco de noche y

8. Mi tía Luisa, la viuda, siempre vestía de negro, había una brisa ligera.

Explanation:

1.era

2. buscaban

3. dormías

4. podía & decían

5. preparábamos & mirábamos

6. Iban & caminaban

7. Hacía & había

8. Se vestía

How to spell Strategize in Spanish

Answers

Answer:

Estrategias

I hope this helps!

PLEASE HELP ASAPPPPPPPP

Answers

Answer:

31 llamo

32 buscan

33 pasa

34 hacen

35 celebramos

ser and estar help pls thx

Answers

Answer:

1.) Nosotras estamos muy ocupadas. "We are very busy." (Feminine)

2.) ¿De dónde eres usted? "Where are you from?" (Polite)

3.) Esos señores son españoles. "Those men are Spanish."

Ser is permanent and can't be changed, however there are some exceptions... estar is something that can be changed and is only temporary.

Answer:

Nosotras estamos muy ocupadas

De donde eres Ud.?

Esos senores son espanoles

Explanation:

Que verbos se emplean para narrar sucesos relevantes en la vida del personaje

Answers

Explanation:

sobre que leccion estas leendo

y quien es el personaje

Al narrar la vida del personaje es necesario relatar algunos hechos o situaciones que sucedieron de manera simultánea  durante un tiempo prolongado en el pasado, y para que eso quede claro, se utiliza el tiempo copretérito que permite, además, señalar aquellos aspectos o rasgos que distinguen al personaje de otros, es decir, caracterizarlo. A continuación se presenta un ejemplo relacionado con la vida de Sor Juana Inés de la Cruz para que puedas apreciar claramente este tiempo:

esa es una biografia de francisco

(Caracas, 1750 - San Fernando, Cádiz, 1816) Precursor del movimiento de emancipación de Hispanoamérica. Era hijo de un comerciante canario que había hecho fortuna en Venezuela. Francisco de Miranda estudió en la Universidad de Caracas y se alistó en el ejército español en 1771.

Fill in the blanks with the appropriate forms of the verb decir. (Digo/dices/dice/decimos/deís/dicen) < Use these

1. Mis hermanos _ que tú eres muy bonita
2. ¿ Tú _ que tu mamá no está?
3. Juan y yo siempre _ la verdad.
4. Ella _ las respuestas.
5. ¿Cómo se _ "books" en español?
6. Pablo y Ana _ que van al cine.
7. Mi madre _ que no.
8. Usted _ que tenemos un examen hoy.

Answers

dicen-dices-decimos-dice-dice-dicen-dice(dijo)-dice(dijo)

Mi lunar favorito es 1.___________ (sustantivo) me gusta ir alli porque es 2.________ (adjetivo) Cuando voy a mi lugar favorito me gusta 3._____(verbo) 4._________ (conjucion) cantar con mis amigos 5.________

Answers

1. el parque
2. bello
3. caminar
4. y

Turismo en Rep Dom
"Sitios históricos en Santo
Domingo
* Playas en Rep Dom
La Selva dominicana
El Cima, el relieve y la
vegetación en Rep. Dom​

Answers

Answer:

what about this?

Explanation:

How can I help?

Only answer if u do flvs
Listen and choose the correct option.



Based on the audio, what could be one adjective that describes Elena?

She is athletic.
She is creative.
She is artistic.
She is shy.

Answers

Answer:

2

Explanation:

Answer:

Athletic

Explanation:

Indicate the correct answer.
cómico ____ gracioso
a) =

b) ≠

Answers

Answer:

its b

Explanation:

The correct answer would be “B”

PLEASE HELP ME I DONT WANT TK TAKE ANOTHER SPANISH CLASS NEXT YEAR​

Answers

Answer:

teléfono  (esdrújula)Rotos  (sin acento)frío  (aguda)sábado (esdrújula)Lejos (sin acento)débiles (esdrújula)álbum (llana o grave)máquina (esdrújula)Perfume (sin acento)árbol (llana o grave)

Need help urgent please!!!

Answers

answer:

estudiaba (studied)

Explanation:

estudiaba Is study but in past tense, it will basically say "when i was twelve years old, I didn't study for my clases" hope this helped

Please help meeee with thissss

Answers

Answer:

1.) Ellos

2.) Ellas

3.) Nosotros

4.) (A friends name) y yo

5.) Él

Hope that this helps!!

1. Comen
2. Comen
3.comemos
4.comemos
5.come

En México empezó el movimiento del arte público y se extendió por todo Latinoamérica. Muchos artistas famosos como Diego Rivera y Salvador González hicieron pinturas grandes. ¿Cuáles son los lienzos de las obras de los muralistas? Las estatuas Los muros Las arcillas Los oscuros

Answers

Answer:

Mexican muralism was the promotion of mural painting starting in the 1920s, generally with social and political messages as part of efforts to reunify the country under the post-Mexican Revolution government. It was headed by "the big three" painters, Diego Rivera, José Clemente ... The first Mexican mural painter to use philosophical themes in his work was

Explanation:

Answer:

Los muros is the correct answer

Juan ________ el traje negro. Él y su hermano Esteban ________ los pantalones y la camisa azul para la boda de su tío. (1 point)
se quita; nos ponemos
se quitan; nos ponemos
se quitan; se ponen
se quita; se ponen

Answers

Juan “se quita” el traje negro. El y su hermano esteban “se ponen” los pantalones y la camisa azul para la boda de su tío.
Juan se quita el traje negro. El y su hermano Estaban se ponen los pantalones y la camisa azul para la boda de su tío
( se quita; se ponen ) last option ! :)

1. On a nice day, el cielo (the sky) es
2. La hierba (the grass) es
3. Las manzanas (apples) son
4. Las bananas son
5. At night, el cielo es
6. La naranja (the orange) es

Answers

Answer:

1 azul

2 verde

3 rojas

4 amarillas

5 negro

6 naranja

Explanation:

1. azul (blue)
2. verde (green)
3. rojas (red)
4. amarillas ( yellow)
5. oscuro (dark)
6. naranja (orange)

La comida

Please help!

Answers

1-pastel
2-brócoli
3-queso
5-zanahoria
6-pollo
7-leche
8-pan

Answer:

tartarbroccoliquesodesayuno or cerealeszanahorriapollolechepanpizzahuevos

Quien tenia la clase de espanol en Edginuity? Por que, ahora yo no se nada, ayadume esta detras en un dia de tarea...

Answers

Como te ayudo no hay ninguna pregunta, there are no questions

Does anyone know the answers ?

Answers

Answer:

Es el dic cionario del estudianteSon los cuadernos de las chicasEs la mano de SaraSon las maletas de la turistaSon las computadoras de os profesoresEs el autobús del conductorSon los lápices de la jovenEs la fotografía de los chicosEs la computadora de la directoraEs el País de David.

Es el lunes por la mañana. Utiliza el pasado para decir a tus amigos sobre toda la diversión que tú tuviste, o no tuviste, durante el fin de semana en la playa.

Answers

Answer:

El fin de semana fui a la playa e hice muchos castillos de arena y hasta enterramos a mi hermana. Estuvimos como 3 horas dentro del agua salpicandonos y jugando con pistolas de agua. Todo estaba bien hasta que ella empezó a lanzarme arena en la cara. En ese momento me enfade mucho y fui a donde mamá. Se enojo con nosotros y nos fuimos de la playa. En verdad hubiese preferido no decirle nada a mami en ese momento para que me hubiese quedado más tiempo.

2) ¿Cuál es la relación de la meiosis con la gametogénesis?

Answers

La Meiosis es parte de un proceso mayor llamado Gametogénesis, la cual ocurre en las gónadas y tiene por objetivo la formación de gametos haploides, por lo tanto la gametogénesis y por ende la meiosis ocurren solamente en células germinales localizadas en las gónadas de los organismos sexuados

^^^ They are correct !!

emergency please help me .
Write a blog post, in Spanish, that describes what to do in different emergencies. Write about 5 sentences and use the subjunctive in your answer.​

Answers

Answer:

1)  ve a un lugar seguro, si puedes

2) mantente calmado

3) tienes que llamar al 911

4) Obtenga tanta información sobre la emergencia como sea posible, sin ponerse en peligro. Transmita la información a los servicios de emergencia cuando lleguen al lugar.

5) espera por ayuda, si no corres peligro

hiiiiiiiii

plz marked as brainlisttttt

Answer:

Si tienes un accidente, es necesario que tengas una lista de números telefónicos de emergencia. En caso de una lesión, es necesario que llames al servicio de ambulancia. Si eres víctima de un robo, es importante que hagas una denuncia policial. Es aconsejable que no vayas cerca de un fuego y llames a los bomberos.

Explanation: Plato/ Edmentum Users

Indicate whether the statement is true or false.
Las clases interesantes son aburridas.
Question 7 options:
a) True
b) False

Answers

false because it says that and interesting class is boring and that is not true

Choose the correct translation of the following time.

6:15

A. Son las seis y cuarto.
B. Son las seis menos cuarto.
C. Es las seis quince.
D. Es las seis y cuarto.

Answers

Answer:

A.Son las seis u cuarto

Explanation:

Because Son las seis y cuarto is *6:15* and son las menos cuarto is *5:45*

I hope this helped!

Answer:

A. son Las seis y cuarto

Explanation:

hope this helps

¿Adónde va Ud. esta tarde? _________ al banco.

Answers

the correct word is Voy

Answer:

Explanation:

Voy al banco

II. Your doting grandmother is offering to do too much. Say yes or no to her questions as
indicated by giving an appropriate command, and replace the objects with pronouns. Use the
tú form as in the example. Be careful with pronoun placement and accent marks! (16 points; 4
points each)

Example:
¿Te preparo un chocolate? (si) Sí, prepáramelo.

¿Te hago un té? (no) No, no me lo hagas.

¿Te lavo la ropa? (no)

Answer:

¿Te Digo la verdad? (Sí)

¿Le preparo un café a tu papá? (No)

¿Les compro ropa nueva a ti y a tu hermana? (Sí)

Answers

1. Si, dime la verdad.
2. No, no le prepares un cafe a mi papa.
3. Si, compranos nueva ropa a mi y a mi hermana.

En una obra dramática, la resolución de las fuerzas en pugna (protagonista – antagonista) se conoce con el nombre de ?

Answers

Teatro teatro teatro teatro

WILL GIVE BRAINLIEST!!!!

Answers

El primer piso. Basically this translates to “the room is on the first floor” the other ones don’t make any sense. Like the window, the door, the garden, because obviously rooms can’t be in those places. Hope this helps!!

Answer:

El primer piso

Explanation:

El cuarto está en el primer piso

Please help me it needs to be done soon

Answers

Explanation:

it didnt let me post the anwers, i dont know why but bye have a great day<3

Pls help me ill give brainliest

Answers

1. Ellas deberían ir a la escuela temprano
2. Ben y Molly leen muchos libros
3. Ava y yo abrimos el libro en la clase
Other Questions
A news report says that 9% of middle school students are on the track team. There are 600 students in your middle school How many students in your school would you expect to be on the track team? HE Pad SATTE BAR HG West nus SAUNA w 1 PLEASE HELP! THIS A TIMED QUIZ!!Scientists found an artifact that has 25% of Carbon-14 left. Based on how much Carbon-14 is remaining, how old is the artifact that was found?A). 17,100 yearsB). 5,700 yearsC). 22,800 yearsD). 11,400 years Please help asap! Ill give brainliest!What theme does the excerpt convey?It is right to be wary of the unknown.Pride interferes with progress.Manners must be displayed in all situations.Strange animals cannot be trusted. What is your response? Why do u think sunny asks so many questions? anyone out there an expert on dreams?? Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date. Est ce que quelqu'un pourrait bien corriger mon expression ecrite ou donner son avie dessus s'il vous plait A $10,000 bond with 18%/year, compounded semi-annually (interest is paid every six month) is available in the market. The bond matures in 10 years. The closest PW of this bond if the purchaser can earn 12%/year, compounded quarterly is:_____. My annoying brother likes to drive me crazy. There is no other who is that lazy. He whines to my mom night and day, until eventually gets his way. What is a sister to do, when he screams til he's blue? There is no way to win, for he gets under your skin. He does his best to kill all joy. Oh, how my brother does annoy! What is the tone of the poem