Is anyone good at writing? If you are plz help me with the question below.

How was Amanda treated as an umpire in comparison to male umpires? It has to be at least 1 paragraph or less.

Answers

Answer 1

Amanda was treated differently than the other empires because she is a girl. they think that she isn't good enough because they think guys are better than girls. they think guys are stronger.


Related Questions

What is the connotation of roared in the following sentence?

Mom roared, "Come down for dinner. NOW!"

Roared shows that Mom is a little irritated.
Roared suggests that Mom has lost her patience.
Roared demonstrates that Mom handles with her children in an animalistic way.
Roared illustrates that Mom is worried that dinner will be too cold to eat.

Answers

Answer:

Roared suggests that Mom has lost her patience.

she said what a pity you missed that function​

Answers

Answer:

wait wht do u mean ???????

Which rhetorical technique is the speaker using?

Read the excerpt from a speech by the class president petitioning the principal to build a new stadium.

Our stadium is crumbling, and the effects have been felt for generations! If we built a new stadium, our community would benefit, and millions would flock to town for the home games. Profits would soar, as local businesses would be flooded with new clients on game nights. And your legacy as the best principal ever would be established for all to see.

a. appeal
b. overstatement
c. parallelism
d. shift

Answers

Answer:

paraallel

Explanation:

just took test spel

Answer: d shift

Explanation:

how to get free followers on ig

Answers

look for apps, you can also go on yt and see if there’s any, some are good and just require you to do tasks and things of the sort
Follow a lot of verified famous celebrity’s and unfollow and follow them like three times a week and you get random followers

Help number 5 is the one I need help with

Answers

Answer:

I think it is D.

Hi guys
How do you do Question 4 Paper 2 Language for a good grade ? I mean what sentence starters do you recommend?

Answers

Answer:

IMAGE?

Explanation:

Roberto is writing an article for his town newspaper, arguing against plans to build a new shopping center in a local meadow. Read this sentence from his article:


State conservation officials noted that "the loss of the open meadow will further reduce the habitat for local wildlife, which is already under pressure from new housing developments near the town forest."


Why did Roberto include this sentence?


A.

He needed to cite a credible source for evidence to support his claim.

B.

He needed to clearly explain his position on the topic by stating a claim.

C.

He needed to demonstrate understanding by clearly describing the topic.

D.

He needed to introduce the topic of his article and give basic details about it.

Answers

Answer:

C

Explanation:

Roberto includes this sentence because he needed to demonstrate understanding by clearly describing the topic. The correct option is C.

What is a habitat?

A habitat is a place where an organism lives. Habitat provides all of the environmental conditions that an organism requires to survive.

"The loss of the open meadow will further limit the habitat for local wildlife, which is already under strain from new house developments near the town forest," Roberto writes. to demonstrate that he knew the subject

There are numerous reasons why Roberto should cite a credible source to back up his claim that a mall should not be built in the middle of a field. She mistook him for warning them about the environmental consequences of developing a mall.

Therefore, the correct option is C. He needed to demonstrate understanding by clearly describing the topic.

To learn more about Roberto article, refer to the link:

https://brainly.com/question/9682089

#SPJ5

I know I had already ask a question and I really appreciate for those who help me. But I really need help on this I need to write a poem but I’m not so great at, if you can read it, it will say everything. Please?

Answers

Answer:

i would love to help u but i need to know what you would like to write about for a topic

Explanation:

think about something you care about or something you like, and maybe you can create a character, or write from your own pov! sometimes the hardest part is picking a topic, and once you get it, and you really like the topic and are happy writing about it, you'll flow writing it!

fast help
How would you react if you were in terry fox position with no leg

Answers

I would cry myself to sleep every single night

Write an argumentative essay about whether you think technology and the Internet have brought young people closer together. Use evidence from research to support your position.

Answers

Technology and the internet have drastically reduced distance and improved the way we see communication.

What is an argumentative essay?

An argumentative essay is one that has a legal implications and the response to the question promotes the witness to make out an inference. They are created for the witness to argue and discuss.

The essay on the technology and the internet have brought people closer and have enabled the use of the digital medium as per the youth and young generation the use of the internet is rising and is fast growing.

Find out more infirmation about the argumentative essay.

brainly.com/question/22740197

Why is defending rights important

Answers

Answer:

While human rights provide rights and freedoms, a person’s ability to enjoy such rights will be dependent on other’s ability to respect that. As such, there is a degree of responsibility that comes with the enjoyment of human rights.

Indifference is becoming a global affliction. With barbarous human right abuses taking place across the world, it is easy to become overwhelmed and fall into apathy. It is important to remember that neutrality is a decision; choosing not to act in the face of injustice will only perpetuate the situation.

What is the subject in the following sentence?

Didn't that old war movie end strangely?

Answers

Answer:

Old war movie is the subject.

Explanation:

A subject is a person, place, or thing

Hope this helps! :)

50 POINTS, BRAINIEST ,5 STARS, and a HEART
Tell me 5 quotes from "Lets pretend that never happened" by Jim benton . That describe Jamie Kelly (personality traits so her thoughts, feelings, and Behavior get that in the book) (physical characteristics so what she looks like book get that in the book), INCLUDE QUOTATION MARKS AND PAGE NUMBER?

Answers

Answer:

in a paragraph??

Explanation:

Answer:

don't know

Explanation:

How can a poem teach about real places and events?

Answers

Answer:

It may teach real-world stories in a likable, entertaining description. People like to hear stories in a lovable way.

it could teach them about real life issues problems in a way that easy and understanding and not too harsh.

Read the excerpt from "Island of Hope, Island of Tears." If illness was suspected, immigrants were detained at Ellis Island's hospital complex. Which statement best describes the text structure of this sentence and explains why it is used? A sequence text structure is used to describe the order of events at Ellis Island's hospital complex. A compare-and-contrast text structure is used to show the relationship between illness and treatment. A sequence text structure is used to explain the order of events that occurred after an immigrant was detained. A cause-and-effect text structure is used to explain why immigrants could be detained at the hospital complex.

Answers

Answer:

A cause-and-effect text structure is used to explain why immigrants could be detained at the hospital complex.

Explanation:

A cause-and-effect text structure is when the author presents a reason why some things happen, presenting the cause and the effect of that scene. This means that the reason why such and such happen is given alongside the result of that.

In the given scenario from "Island of Hope, Island of Tears", the author Niall O’Brien uses the cause-and-effect text structure. He states how immigrants were detained at the hospital complex if any illness was suspected. In this statement, the cause is the detection of illness while the effect is the detention at the hospital complex.

Thus, the correct answer is the fourth/ last option.

Explanation ANS

Immigrants may be kept at the facility complex, as explained using a cause-and-effect narrative structure.

Explain the adverb distinction between the underlined terms. 1 Priyanka is sitting in front. 2) Rahul is inside. 3) The car was running fast. 4) Honey sit here.

Answers

Explanation:

Remember, an adverb often refers to a word that modifies or describes a verb, or an entire sentence. Note, the bolded word indicates the adverb in each sentence below:

1) Priyanka is sitting in front.

The adverb distinction here is that it answers the question of where? In other words, where is Priyanka sitting? in front.

2) Rahul is inside.

This adverb also answers the question of where? In other words, where is Rahul? inside.

3) The car was running fast.

The adverb here answers the question of manner? In other words,  in what manner was the car running? fast.

4) Honey sit here.

This adverb also answers the question of where? In other words, where should "Honey" sit? here.

identify the verb: The day was hot?​

Answers

Answer:

Hot is the verb

The authors' most likely purpose for including the image in paragraph 8

Answers

Answer:

BANKRUPT

Explanation:

Answer:

Highey think its D

Explanation:

Its funny cuz hes short lol

So that thus it is, that natural men are held in the hand of God, over the pit of hell; they have deserved the fiery pit, and are already sentenced to it; and God is dreadfully provoked, his anger is as great towards them as to those that are actually suffering the executions of the fierceness of his wrath in hell; and they have done nothing in the least to appease or abate that anger.


In this excerpt, "natural" is used to describe people who

are not tempted by wealth or power.

have not been touched by the spirit of God.

live on farms or in the wilderness outside of cities.

practice conservation and avoid destroying the beauty of nature.

Answers

Answer:B

Explanation:

From what I can tell I think it’s that they have not been touched by the spirit of god. They proclaim them natural which doesn’t seem to be relating to farm life or conservation of nature as c and d propose. God in this context seem to be getting upset. These “natural men” seem to have deserved this hell and apparently been “sinful” in some way. If the answer were to be A then the men would most likely not be sent to hell and provoke god in the way that they did. So I believe the answer is B

what are good anime to watch please answer

Answers

Answer:

1:jujitsu kaisen 2:fire force 3:rising of the shield hero

Answer:

i do not really watch anime sorry

what is the central idea in scarlet ibis

Answers

Answer:

The theme, or central idea, of "The Scarlet Ibis" is do not take the family for granted. The reader can infer this, because of the characters in the story. Doodle is abused by his brother (the narrator). After Doodle passes away, due to his irresponsible brother's actions, the narrator becomes regretful.

Explanation:

Write an rough draft that analyzes the use of poetry in Through the Looking-Glass.

Answers

Answer:

I think the topic about through the looking glass is about growing up plus how Alice has to face some stuff on her own like going through lonely things and humpty being mean to her and her not understanding the other world so much.

Explanation:

I hope this helps B) please mark me brainiest

I got it right on mine

Why does Antigone bring her sister outside of the city gates?

Answers

Answer:

to tell her something about buryijng their brother

Explanation:

For a secret meeting

Which sentence shows the best placement for the modifier “on the ice”

A. After dinner on the ice, we all went skating

B. We all went on the ice after skating

C. We all went skating after dinner on the ice

D. After dinner, we all went skating on the ice

Answers

The correct answer would be a

Answer:D. After dinner, we all went skating on the ice

Explanation: i took the test and got it right

3. What is true of Leo Borlock?
He is best friends with Wayne Parr.
He has two brothers.
He is not originally from Arizona.
He is outgoing and boisterous.
k

Answers

Answer:

The third option

Explanation:

He is not originally from Arizona, he was the new kid in the school.

His best friend was Kevin Quinlan

He was an only child

He was very shy and self conscious

Read the excerpt from Homecoming.

With her brothers and sisters near, with the two youngest asleep in the back seat, sitting as they were in a cocoon of darkness, she should feel safe. But she didn't. Though it was standing still, the car seemed to be flying down a highway, going too fast. Even the dark inside of it was not deep enough to hide them. Faces might appear in the windows at any time, asking angry questions.

What point of view does the excerpt show?

first-person point of view
second-person point of view
third-person point of view
first- and third-person point of view

Answers

The answer is third person point of view!

Answer:

the answer is third person point of view hope this helps!!

Explanation:

There were six people in the basket of a hot air balloon which was starting to fall because it could not support the weight of the people traveling in it. If you were asked to choose the person, who would you choose why?The travellers were a teacher, a doctor,an engineer,a business person,a scientist and a leader

Answers

A teacher because they’d be the least useful

Answer:

The Engineer

Explanation:

He/she is most likely in the hot air balloon to see if the hot air balloon has any problems or to fix it and for him/her to either one of those things he/she will need a toolbox or a tool belt. So he/she is most likely weighting the hot air balloon down.

I hope I asked your question :)

why did Emily Dickinson used unconventional capitalization

Answers

Answer:

i have no idea (;

Explanation:

Answer:

Emily Dickinson capitalized certain words to highlight and intensify the meaning. The capitalization is used to set apart the words so she can present them in a symbolic way. Some critics say that Dickinson wrote her poetry to celebrate the exact and perfection of a word.

Explanation:

Help pleaseee

Billy Weaver's character can best be described as in the story Landlady
A. cruel and mean
B. sad and lonely
C. clever and creative
D. simple and trusting

Answers

Answer:

simple and trusting

Explanation:

What two events does anne mention that might affect the inhabitants of the annex greatly?

Answers

Answer:

It worsened such as less food. Mr.Kraler gets sick, and Miep has a hard time finding food

Explanation:

Other Questions
What does this quote mean? Thanks! Ayala is making salad dressing. She mixes oil andvinegar in a blender until a smooth consistency isformed. Explain whether this is a heterogeneous or ahomogeneous mixture and why. Help?Jessica must determine how many packages of cookies and cupcakes to buy for her family reunion. Jessica's mother has asked her to buy the same number of each type of item but no more than 100 of each. At the bakery, Jessica finds that cookies are sold in packages of 12 and cupcakes are sold in packages of 9.Use the drop-down menus to select the answers that make each statement true.The greatest number of packages that Jessica can buy is _ packages of cookies and _ packages of cupcakes. explain what happens when particles collide When a story is told from the _____, the narrator has full knowledge of all the characters. omniscient third-person point of view reliable first-person point of view unreliable first-person point of view limited third-person point of view The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut a student performed an experiment, using a cocktail peanut, before it was burned the peanut half weighed .353 g. After burning the residue weighed .016 g. The energy released by the conjunction increased the temperature of 200. mL of water in the calorimeter by 7.2 degrees Celsius. Calculate the mass of peanut consumed in the combustion. twice the sum of k and 9 is 4 The product of a number and -5 is at least 35. Write as an inequality. who killed the district judge during the revolutionary movementanswer in one sentence Quick question for you all People who complain that video games involve too much sitting are probably old. They probably dont know very much about gaming, either. They dont realize that people can play virtual sports, such as tennis, on video games. There are video games for dancing, too. If people bothered to learn about the different kinds of video games, they would see how wrong they are. This students sample paragraph addresses the counterclaim. Critique this paragraph by answering the questions.What is the counterclaim?Video games are too violent.Video games make people inactive.Video games are different today.What evidence weakens the counterclaim?People who complain are old.Sitting too much is bad for people.There are video games for sports and dancing.What is the tone of the rebuttal?respectfulrudehumorous Mention the type of seeds that undergo hypogeal germination.What do we call the process of permanently stopping babies from breast feeding?plzz help it is due today 2) look closely at article XLVII. Rephrase it in your own words. How do you think this impacted the unity among slaves during the revolution?Please I need help! Use the interactive tool to graph the line given the following information: coordinates (1,3) slope of 2Based on your investigation, what is the value of b for the point (0,b)? what is carbogen and it's uses Please help!!!! ASAP!!! Thank you!!! Brainliest to right answer also based on answer 1 are the equations equivalent?