Plz Help...
Find x in the given triangle.

Plz Help...Find X In The Given Triangle.

Answers

Answer 1

Answer:

[tex]\huge\boxed{x=2\sqrt{286}}[/tex]

Step-by-step explanation:

Use the Pythagorean theorem:

[tex]leg^2+leg^2=hypotenuse^2[/tex]

We have:

[tex]leg=x\\leg=15\\hypotenuse=37[/tex]

Substitute and solve for x:

[tex]x^2+15^2=37^2\\\\x^2+225=1269\qquad|\text{subtract 225 from both sides}\\\\x^2+225-225=1269-225\\\\x^2=1144\to x=\sqrt{1144}\\\\x=\sqrt{4\cdot286}\\\\x=\sqrt4\cdot\sqrt{286}\\\\x=2\sqrt{286}[/tex]


Related Questions

What is the slope of the line 4x-2y=5

Answers

Answer:

slope = 2

Step-by-step explanation:

Answer: C

Step-by-step explanation:

Edgen 2023

Charlotte wants to solve the equation 6(2x+1) – 3 = 4x – 5. Which step would be an appropriate first step for Charlotte to take to solve for x?

A. Subtract 1 from both sides to combine like terms
B. Add 4x to both sides to isolate the variable
C. Distribute the 6 to eliminate the parentheses
D. Combine 4x and -5 to simplify the problem

Answers

Answer:

C.

Step-by-step explanation:

c is the only one that even makes sense

C. Distribute 6 to eliminate the parentheses.

What are some rules to solve an equation ?

To solve an equation we follow BODMAS rule which stands for first solving which are inside brackets then we divide terms to each other if division is given.Then we multiply terms if multiplication is given.Next step we add terms if given.In last we do subtraction if it is in the given expression.If any of these operations are not given we just skip and do the next operation according to the BODMAS rule.

According to the given question

Charlotte wants to solve the equation 6(2x+1) – 3 = 4x – 5.

6( 2x + 1 ) - 3 = 4x - 5

12x + 6 - 3 = 4x - 5

12x + 3 = 4x - 5

12x - 4x = - 5 - 3

8x = - 8

 x = -8/8

 x = -1

Learn more about BODMAS rule here :

https://brainly.com/question/23827397

#SPJ6

Evaluate -8 - 21.
-10
-16
16
10

Answers

Answer:

Evaluate -8 - 21.

-10

-16

16

10

There are approximately 7.5 x 10^18 grains of sand on earth. There are approximately 7x10^27 atoms in and average human body. Are there more grains of sand on earth or atoms in a human body?

Answers

There are more atoms in a human body because 7.5*10^18 is less than 7*10^27.

When Carla looked at the library, she noticed that for every 2 nonfiction books, there were 5 fiction books. If there are 161 books total, how many of them are not nonfiction books.

Answers

Answer:

138 nonfiction

Step-by-step explanation:

Ratio problem, we are going to use the part to all approach

Step one:

given data

the ratio of nonfiction to fiction books is 2 to 5

otherwise expressed as 2:5

the total ratio is 2+5= 7

the total number of books is 161,

applying the part to all approach

nonfiction to all is

let the nonfiction be x

2/7=x/161

cross multiply we have

7x= 161*6

7x=966

divide both sides by 7

x=966/7

x=138 nonfiction

138 nonfiction

24 POINTS.
(U also have to explain the reasoning you used to find the value of P)

Answers

9514 1404 393

Answer:

  P = 70 +4x

Step-by-step explanation:

From your previous work with the parking lot, you know its area is ...

  A = 560 +32x

The width of the parking lot extension is (52 -20 -24) = 8 yards, so its area is ...

  extension area = 8P

We want the extension area to be equal to the original area so that adding the extension will double the area:

  extension area = A

  8P = 560 +32x

  P = 70 +4x . . . . . . divide by 8



If the ice cream truck sales 90 ice cream cones, how hot could you predict it was outside?
0 95
105
102
O
100

Answers

Answer:

It would most likely be in the 100's so maybe 105

Roman civilization began in 509 BC and ended in 476 A.D Roman civilization last show working​

Answers

Answer:

Roman civilization lasted for 985 years.

Step-by-step explanation:

Given that Roman civilization began in 509 BC and ended in 476 A.

All we have to do is to subtract -579 from 476.

i.e.

[tex]476 - (-509)[/tex]

[tex]=476+509[/tex]

[tex]=985[/tex] years

Thus, Roman civilization lasted for 985 years.

4) Rosemary had $25 to spend on school supplies. She buys 4
packages of mechanical pencils. After her trip to the store, she onl
has $1 left. How much did each pack of pencils cost?

Answers

Answer:

Each pack costed 6 dollars

Step-by-step explanation:

Answer:

Each pack costs 6 dollars

Step-by-step explanation:

4x+1=25

4x=24

X=6

9x-4y=17 for y
answer it for me plz

Answers

Answer:

9x-4y=17

-4y=-9x+17

y=9/4x+17

Step-by-step explanation:

REALLY NEED HELP PLEASE!!

Answers

Step-by-step explanation:

sum of angles in triangle is 180

so 80 + 40 + angle 2 = 180 angle 2 = 60

angles 1 and 2 is 60 and angles 3 and 4 is 35

say they wanna read my mind.. they really wanna read my mind.. telling you rn all you’ll find is a lost soul rich and blind

Answers

They want to read my mind they really want to read my mind.

Please anyone help me

Answers

Answer: Are we supposed to solve for y or?

Step-by-step explanation:

warning: sorry if this doesn't make sense but this all i can get out of this one

-2x + y = -9

x = 9/2 + y/2

y = -9 + 2x

------

same warning here

12x + 3y = 9

x =3/4 - y/2

y = 3 - 4x

sorry if this doesn't help but i hope it does

Help me with the questions 1-4, thank you! :)

Answers

Answer:

1) Slope is 2/1 and the y-intercept is 2 --> y = 2x+ 2

2) Slope is -1/3 and the y-intercept is -3 --> y = -1/3x -3

The images for question 3 and 4 are below:

The equations for

3) y = 1/3x - 5

4) y = -2x-8

Step-by-step explanation:

Ben is going to an amusement park with his scout troop. He has $80 in his wallet. If admission costs $18.95, a book of ride tickets costs $26.50, and lunch costs $9.20, round each amount to the nearest dollar to find out about how much Ben will have left to buy a souvenir. A. $15 B. $25 C. $32 D. $38

Answers

Answer:

B

Step-by-step explanation:

because thats what google say lol

I would greatly appreciate it if you would help me

Answers

Answer:-1

Step-by-step explanation:

the output of a function is the y value while the input is the x value.

so the question is asking what does the y value( output) have to be for the x value( input) to be zero.

since the graph is provided we can just look to see where the x values becomes zero ( the y axis is when all y values are zero)

we then can identify that the y intercept is -1

hope this helps!!

Graphing two-variable linear equalities

Answers

Answer:

What is the problem so we can help you

Jessica rode her bike for 2 hours at the speed of 23 miles per hour. How far did she travel?

Answers

2 times 23
answer is 46

Raymond bought a book that cost C = 1.065x after sales tax. How could he rewrite the cost equation to emphasize the base price of the book and the amount he paid in tax? C= x + 0.065 A B. C= x + 0.065x с C=1+ 0.065 D C=1+ 0.0652​

Answers

Answer:

C

Step-by-step explanation:

The choir at wise middle school was preparing for their Hispanic concert. While rehearsing their opening song they noticed it took 48.7 seconds to sing it.They felt it was too long and sang it again taking off 2.9 seconds from the original time. The third time they sang it they were able to take an additional 0.47 seconds off their time. How long did it take the choir to sing the song the third time?

Answers

Answer:

45.88 seconds

Step-by-step explanation:

[tex]t_1[/tex] = Time taken to sing the fist time = [tex]48.7\ \text{s}[/tex]

Time taken to sing the second time was [tex]2.9\ \text{s}[/tex] less than the first time so

[tex]t_2=t_1-2.9\\\Rightarrow t_2=48.7-2.9\\\Rightarrow t_2=45.8\ \text{s}[/tex]

Time taken to sing the third time was [tex]0.47\ \text{s}[/tex] less than the the second time

[tex]t_3=t_2-0.47\\\Rightarrow t_3=45.8-0.47\\\Rightarrow t_3=45.88\ \text{s}[/tex]

So the time it took the choir to sing the third time was 45.88 seconds.

Explain why the slope of the line drawn in part C must be negative.

Answers

because it is a negative line in the graph

Does anyone know what the answer is ?

Answers

Answer:

x intercept : -3,0 y intercept : 0,6

Bamboo Plant A is 1.2 meters tall and growing at a rate of 0.45 meter per day. Bamboo Plant B is 0.85 meter tall and growing 0.5 meter per day. After how many days will Plant B be taller than Plant A?

Answers

Answer:

7 days

Step-by-step explanation:

Bamboo plant A = 1.2 + 0.45d

Bamboo plant B = 0.85 + 0.5d

Where,

d = number of days

Equate the two growth

Bamboo plant A = Bamboo plant B

1.2 + 0.45d = 0.85 + 0.5d

Collect like terms

1.2 - 0.85 = 0.5d - 0.45d

0.35 = 0.05d

Divide both sides by 0.05

d = 0.35 / 0.05

d = 7 days

Plant B be taller than Plant A after 7 days

help me please with this question

Answers

Answer:

see explanation

Step-by-step explanation:

2B + 3C

= 2 [tex]\left[\begin{array}{ccc}4&-5\\-2&1\\\end{array}\right][/tex] + 3 [tex]\left[\begin{array}{ccc}1&-1\\-6&3\\\end{array}\right][/tex]

Multiply each element in the matrices by the scalar quantity, that is

= [tex]\left[\begin{array}{ccc}8&-10\\-4&2\\\end{array}\right][/tex] + [tex]\left[\begin{array}{ccc}3&-3\\-18&9\\\end{array}\right][/tex]

Add corresponding elements from each matrix

= [tex]\left[\begin{array}{ccc}8+3&-10-3\\-4-18&2+9\\\end{array}\right][/tex]

= [tex]\left[\begin{array}{ccc}11&-13\\-22&11\\\end{array}\right][/tex]

two fair dice are rolled. the score is the difference between the two dice. some of the possible scores are shown in the table.
c) which score has a probability of occurring 1/18

Answers

Answer:

Step-by-step explanation:

a). From the table attached,

   Number in 1st column and 1st row = 1 - 1 = 0

   Number in 1st column and 6th row = 6 - 1 = 5

   Number in 2nd column and 4th row = 4 - 2 = 2

   Number in 5th column and 2nd row = 5 - 2 = 3

   Number in 6th column and 5th row = 6 - 5 = 1

b). Probability of scoring 1 = [tex]\frac{\text{Preferred outcome}}{\text{Total outcomes}}[/tex]

   Preferred outcomes of getting = 10

   Total outcomes = 36

   Probability of scoring 1 = [tex]\frac{10}{36}[/tex]

                                          = [tex]\frac{5}{18}[/tex]

c). Probability of occurring a score = [tex]\frac{1}{18}[/tex]

                                                         = [tex]\frac{1\times 2}{18\times 2}[/tex]

                                                         = [tex]\frac{2}{36}[/tex]

                                                         = [tex]\frac{\text{Preferred outcome}}{\text{Total outcomes}}[/tex]

   Since, 5 is a number which has occurred twice

   Score that has a probability of occurring of [tex]\frac{1}{18}[/tex] is 5.

Which numbers are integers
4

-3
42/6
-5.6
5.423
-54
98
54/6

Answers

4,-3,-54,98, 54/6, 42/6

In the number 707B47.B is a prime number.If the number is rounder off to 3sf its value is 708000 what is the biggest value of B

Answers

Answer:  7

The list of single digit primes is {2,3,5,7}. The largest prime is 7, so B = 7 is the largest possible value.

Also note how 707,747 rounds to 708,000 when rounding to 3 significant figures.

Helps me solve this problem please

Answers

Answer:

Option 1: -2

Step-by-step explanation:

Take the rise over the run, where rise is the number of units vertically up the graph and run is the number of units horizontally across the graph

This is a topic on coordinate geometry. If you wish to explore more into this topic you can give me a follow on Instagram (learntionary). I'll be uploading notes on this topic soon. At the meantime, you can take a look at other topics or some tips as well!

Elena knows that 5 servings of granola have 1,750 calories. if she eats 2 servings of granola,how many calories dose she eat

Answers

Answer:

700 calories

Step-by-step explanation:

1,750/5

=350

350colories per serving

So multiply 350 by 2

350x2

=700

Answer:

Elena eats 700 calories

Step-by-step explanation:

First, we need to find out how many calories are in one serving of granola. To do that, we will divide; 1750/5=350. We now know that there are 350 calories in one serving of granola. However, the problem is asking for how many calories are in two servings of granola. 350 x 2 = 700. Therefore, Elena eats 700 calories.

)A triangle is shown on the graph:

What effect will a 90-degree clockwise rotation have on the triangle? Be sure to address how it could impact the angles, side lengths, and any congruency between the original pre-image and the image.

Answers

Answer:

45

Step-by-step explanation:

Answer:

45 idrk

Step-by-step explanation:

SCOOBY-dooby-do-la-de-da-de-da

Other Questions
This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date. Est ce que quelqu'un pourrait bien corriger mon expression ecrite ou donner son avie dessus s'il vous plait A $10,000 bond with 18%/year, compounded semi-annually (interest is paid every six month) is available in the market. The bond matures in 10 years. The closest PW of this bond if the purchaser can earn 12%/year, compounded quarterly is:_____. My annoying brother likes to drive me crazy. There is no other who is that lazy. He whines to my mom night and day, until eventually gets his way. What is a sister to do, when he screams til he's blue? There is no way to win, for he gets under your skin. He does his best to kill all joy. Oh, how my brother does annoy! What is the tone of the poem PLZ HELP!!!Will mark brainliest44. Show that the quadrilateral with vertices A(0,0), B(a,0), C(a + b, c) and D(b, c) is a parallelogram. hehe i need help with the whole quiz basically:IFind the decimal that is equivalent to: A. 1.714 B. 0.583 C. 0.0583 D. 6. Another engine reaches its top speed from rest in 7.5 s. It is able to perform 250,000 J of wok inthat time How much power does this engine have in that time? The Yellow River is often called the cradle of Chinese civilization. It was along the banks of the Yellow River where the Chinese civilization first formed. The Yellow River is 3,395 miles long, making it the sixth longest river in the world. It is also called the Huang He River.Early Chinese farmers built small villages along the Yellow River. The rich yellow-colored soil was good for growing a grain called millet. The farmers of this area also raised sheep and cattle. Ancient China: Geography,Ken NelsonUsing context clues, which statement best defines the phrase "cradle of Chinese civilization?the place where the longest river in China startsthe place where most people in ancient China livedthe place where people in China began a farming culturethe only place in ancient China where people could farm What is an accurate statement about many of the first Africans to come to Louisiana?They came voluntarily.They were skilled laborers. They came in search of domestic work. They knew how to grow crops. Carter was given a box of assorted chocolates for his birthday. Each night, Carter treated himself to some chocolates. Carter ate 5 chocolates each night and there were originally 30 chocolates in the box. Write an equation for C,C, in terms of t,t, representing the number of chocolates remaining in the box tt days after Carter's birthday. When a space shuttle was launched, the astronauts on board experienced an acceleration of 29.0 m/s2. If one of the astronauts had a mass of 60.0 kg, what net force in Newtons did the astronaut experience? Which equation below has no solution?A) 3(6x + 8) = 24 + 18xB) 8(x + 4) = 12x - 6C) 5x - 4 = 2(4x + 8) - 3x can somebody do 4 and 5 for me