Read the passage, and then answer the question that follows:

Even though it costs less than staying in hotels, family camping has become less popular lately.

In the passage above, how is the transition even though used?

A. To show a contrast
B. To summarize an idea
C. To introduce an idea
D. To show a comparison

Answers

Answer 1

Answer:

D . To show a comparison


Related Questions

Which of the following words is not used as a signal for contrasting?

conversely
likewise
whereas
however

Answers

likewise is the answer

In Paragraph 1 Of The Section“Doc-Lap at Last,” the author says, “The Americans cringed at the thought of a Communist Vietnam.” The word cringe literally means “to bend your head in fear.” In this context, what does cringe mean? What feeling does the word “cringe” give you, and how does that help you understand the main idea of this paragraph?

Answers

Answer:

I think that cringe means that a response to embarrasement. But right now in this text I think this word means that they didn't want that to happen. Or they thought that was not good. Hopefully it's right. I mean that's just my opinion. :D

Explanation:

Read the excerpt from The Call of the Wild.

They stopped by a running stream to drink, and, stopping, Buck remembered John Thornton. He sat down. The wolf started on toward the place from where the call surely came, then returned to him, sniffing noses and making actions as though to encourage him. But Buck turned about and started slowly on the back track. For the better part of an hour the wild brother ran by his side, whining softly. Then he sat down, pointed his nose upward, and howled. It was a mournful howl, and as Buck held steadily on his way he heard it grow faint and fainter until it was lost in the distance.

John Thornton was eating dinner when Buck dashed into camp and sprang upon him in a frenzy of affection, overturning him, scrambling upon him, licking his face, biting his hand – "playing the general tom-fool," as John Thornton characterized it, the while he shook Buck back and forth and cursed him lovingly.

Which theme is supported by Buck's unwillingness to continue the journey with the wolf?

A good, strong leader treats his followers well.
The only way to learn something new is to try it.
Only the strong are able to survive in the wild.
The desire to fight for power is a natural instinct.

Answers

Answer:

Only the strong are able to survive in the wild.

Explanation:

Answer:

A good strong leader treats his followers well.

Explanation:

When I was a child and they burned me out of my home, I was frightened and I ran away. Eventually I ran far away. It was in a place called France. Many of you have been there, and many have not. But I must tell you, ladies and gentlemen, in that country I never feared. It was like a fairyland place.

Identify one type of rhetorical devices used in paragraph and what sentence is it?

Answers

simile in the sentence “It was like a fairyland place.” because it uses the word “like” to compare france to a fairyland place

Identify one type of rhetorical devices used in paragraph and what sentence is it?

I am greatly honored. But I must tell you that a colored woman—or, as you say it here in America, a black woman—is not going there. It is a woman. It is Josephine Baker.

Answers

Answer:

Pathos

Explanation:

A rhetorical device, or a persuasive device, is a technique an author can use to convey (or even trick) the listener or reader something. In this case, the speaker or writer is appealing to the emotion of their audience.

Answer Nya’s question in relation to Salva: Why would Salva, a Dinka, drill a well for his tribe’s enemies, the Nuer?·ω·

Answers

Answer:

The two main differences are that Salve got an education which was noted in Chapter on while Nya did not. Also, Salva is walking to get to the refugee camp which is located in Ethiopia but Nya is walking for a different reason, to retrieve water for her family.

Explanation:

In case you need this too

Easy Question for 10 points

Even though 2020 has been hard, it is good to find things that you are thankful for. What are THREE things that you can be thankful for in this year? WHY?

Answers

I learned how to love myself better, I met new friends and we treat each other like family, and I found my awakening to be a better person.

Evaluate the following statement and choose identify the underlying meaning. According to Albert Einstein, our very existence is inextricably linked to bees - he is reputed to have said: "If the bee disappears off the surface of the globe, then man would only have four years of life left."

a. Humans only have 4 years left to live.
c. Human existence is dependent on bees.
b. Bees are dependent on human existence
d. None of the above

DON'T STEAL MY POINTS OR I REPORT YOU

Answers

Since he said if bees disappear, humans would follow soon after

The answer is C.

Answer:

C

Explanation:

Analyze the impact of specific word choices on tone.
Reread Lady Macbeth's second soliloquy (lines 38-54) in Act I, Scene v, of The
Tragedy of Macbeth. How would you describe her at this point in the play? Identify
examples of word choice that help convey that description.

Answers

Answer:

This speech sets the mood for the horrible events which will follow...namely the murder of Duncan, which leads to the murders and deaths of so many others.

It prepares the audience for what is to come, teaches them about Lady Macbeth's character and what she is capable of, and also informs the audience as to the type of person Macbeth is.  We know, for instance, from her speech, that he would not come up with the idea of murdering Duncan on his own and he certainly would not go through with this plan if she were not there to give him "courage".  

The speech also sets up the theme of gender roles--Lady Macbeth at the beginning is more of the pants-wearing character by her own character analysis than her husband who is, according to her, "too full of the milk of human kindness" to do anything against his beloved King.  

Setting these two up as strong vs. weak at the beginning makes for interesting comparisons later in the play when Lady Macbeth becomes weaker and more human...guilt-ridden and suicidal and when Macbeth begins planning murders without the help of his horrid wife.

Without that speech, the play would be a very different being.  It is essential to not only the plot but character development.

Explanation:

        This soliloquy illustrates Lady Macbeth's moral and physical degradation. She is no longer strong, safe, or capable of taking care of herself. It also conveys the shame she experiences as a result of the killing. She recounts the murder of Duncan first, then Macduff's wife, and finally Banquo in her speech.

What mood does Act 2 of Macbeth's soliloquy convey?

         Even though Macbeth is attempting to boost his confidence, the tone is one of fear. The picture conveys a menacing mood. Even though the tone is one of exhilaration and apprehension, Macbeth exudes terror with both his words and deeds.

     What mood does Act 2 Scene 2 of Macbeth convey?  The atmosphere darkens even further when Macbeth kills Duncan because of his guilt-induced paranoia. When Macbeth returns to his wife in Act 2, Scene 2, he doesn't appear triumphant; instead, he is horrified.

     What mood does Macbeth's soliloquy have? Shakespeare's Macbeth: I. 7.1–28 – Macbeth, a general who will soon become king, delivers this soliloquy. Given that he has only recently given the decision of killing the king serious thought, Macbeth is dubious if it is the wisest course of action.

       What impact does Lady Macbeth's solo speech in Act 1 Scene 5 have?    She berates herself for being feminine in the soliloquy, yelling "unsex me here," and pleading for the milk in her breasts to flagella converted into "gall" so she can kill Duncan herself. These statements illustrate Lady Macbeth's viewpoint that murder is the defining quality of a man.

To Learn more About Lady Macbeth's, Refer:

https://brainly.com/question/25668662

#SPJ2

PLEASE HELP ME!!!

Which of these sentences would most likely be used in a note to a friend?
O
A. I think the Slow Food movement started like 20 years ago.
O
B. The Slow Food movement traces its beginnings to Italy in 1986.
O
C. More than 20 years ago, an important movement started.
O
D. The movement started over 20 years ago and continues to see growth.​

Answers

Answer:

A

Explanation:

Answer:

A.

Explanation:

Read the excerpt from The Riddle of the Rosetta Stone.

The French army stayed behind in Egypt—and so did the scholars. In late August, shortly after Napoleon's departure, a large, heavy package arrived at the scholars' palace in Cairo. When they opened it, they found it contained a black stone slab covered with writing in three different scripts.

A note from a French army officer accompanied the package. He told the scholars that the stone had been unearthed in an old fort near the town of Rosetta, thirty-five miles north of Alexandria. French soldiers were tearing down a ruined wall in the fort when they came upon the slab.

Which statement accurately describes a cause-and-effect relationship described in this excerpt?

Because Napoleon departs for France, the French army and scholars decide to stay in Egypt.
Because the French army and scholars decide to stay in Egypt, Napoleon decides to depart for France.
Because the French soldiers are tearing down a ruined wall in a fort, they discover the Rosetta Stone.
Because the French soldiers are searching for the Rosetta Stone, they tear down a ruined wall in a fort.

Answers

Answer:

Its because the French soldiers are tearing down a ruined wall in a fort, they discover the Rosetta Stone.

Explanation:

In the passage it says that they tore the wall and after they did that they saw the Rosetta Stone.

French soldiers tear down a ruined wall that appears to be Rosetta Stone

i can't sleep so like hi hi

Answers

Lol It’s 7:15 pm where I am, Hi!!

Hi can u please help me find a quote in humanities I read this like 6 times

Oh and explain please and this is 6th grade and last year I wasn’t in a proper 5th grade class I was in a 4th and 5th class and we did fourth grade stuff we just got the notebooks for fifth grade and nevered use

Answers

Answer:

The calling of the humanities is to make us truly human in the best sense of the word.

The imagination is an innate gift, but it needs refinement and cultivation; this is what the humanities provide.

True or False. The ability to make a product cheaply would encourage a country to produce and export it.

Answers

Answer:

True

Explanation:

BRAINLIEST?

Answer:

True, the country's main goal is to make money so making the product cheaply will be easier for the country to make money.

Compare Roosevelt and Muir. Write 3-4 sentences.

Answers

Answer:

Roosevelt and Muir are both incredibly influential people during history, but they still have many differences. One main difference that you can find between the two is how different the places they were born were like, while Roosevelt was born in New York, Muir was born in Scotland. Yet another difference between the two is that Roosevelt was one of the presidents of the United States, and Muir was famous naturalist and conservationist. The two men are both wonderful people who made huge impacts on the world, but in slightly different ways.

In one sentence, develop a claim on the topic of "national parks in the United States.

Please help me

Answers

National Parks in the United States need more protection against hunting.

Which of the following makes a resource reference within an informational text?
a
Summary
b
Paraphrase
c
Internal citation
d
Works Cited page

Answers

Answer:

d

Explanation:

because if it is goong to be an informational text then it has to be work cited so its d

Identify one type of rhetorical devices used in paragraph and what sentence is it?

Friends and brothers and sisters, that is how it went. And when I screamed loud enough, they started to open that door just a little bit, and we all started to be able to squeeze through it. Not just the colored people, but the others as well, the other minorities too, the Orientals, and the Mexicans, and the Indians, both those here in the United States and those from India.

Answers

Answer:

Minorities.... Not just the colored people, but the others as well, the other minorities too, the Orientals, and the Mexicans, and the Indians, both those here in the United States and those from India.

Explanation:

Read the two excerpts from The Call of the Wild describing the wolf.

The wolf whirled about, pivoting on his hind legs after the fashion of Joe and of all cornered husky dogs, snarling and bristling, clipping his teeth together in a continuous and rapid succession of snaps.

***

For the better part of an hour the wild brother ran by his side, whining softly.

How has the wolf changed?

He has become anxious about his pack.
He has become friendlier toward Buck.
He has become timid because of the sounds.
He has become stronger in his demeanor.

Answers

Answer:

B. He has become friendlier toward Buck.

Explanation:

took test

Answer:

B. He has become friendlier toward Buck.

PLS HELP! I WILL MARK FIRST GOOD ANSWER BRAINLIEST!!!


If you could live in any decade, which one would you choose and why? (1 paragraph)



What type of text structure is this?

Answers

Answer:

Personally I would live in this current decade (2020-2029) because even though there has been a lot of bad things this year, there has also been a lot of good things this year.

Explanation:

Read the excerpt from The Call of the Wild.

They saw him marching out of camp, but they did not see the instant and terrible transformation which took place as soon as he was within the secrecy of the forest. He no longer marched. At once he became a thing of the wild, stealing along softly, cat-footed, a passing shadow that appeared and disappeared among the shadows. He knew how to take advantage of every cover, to crawl on his belly like a snake, and like a snake to leap and strike. He could take a ptarmigan from its nest, kill a rabbit as it slept, and snap in mid air the little chipmunks fleeing a second too late for the trees. Fish, in open pools, were not too quick for him; nor were beaver, mending their dams, too wary. He killed to eat, not from wantonness; but he preferred to eat what he killed himself. So a lurking humor ran through his deeds, and it was his delight to steal upon the squirrels, and, when he all but had them, to let them go, chattering in mortal fear to the treetops.

Which theme does this passage illustrate?

A good leader is strong and intelligent and treats his followers well.
Only the strong survive in the wilderness.
The desire to fight for power is an instinct.
The only way to learn something is to try it.

Answers

Answer:

only the strong survive in the wilderness

Answer:

Only the strong survive in the wilderness

Explanation:

Identify one type of rhetorical devices used in paragraph and what sentence is it?

Now I am not going to stand in front of all of you today and take credit for what is happening now. I cannot do that. But I want to take credit for telling you how to do the same thing, and when you scream, friends, I know you will be heard. And you will be heard now.

Answers

Answer:

Sorry for taking up an answer space, but many of us haven't taken the test you are referring to, and can't see the paragraph necessary to complete the question. If you put the paragraph in the question as well, it would be far more likely to be answered quickly and thoroughly.

which sentence correctly uses an adjectival phrase?

Answers

Answer:

b.

Explanation:

what type of rhetorical device is this sentence?
So I did open my mouth, and you know I did scream

Answers

Answer:

I'm thinking maybe Consonance.

It is a Consonance .

How might a supportive person change and impact someone’s life?

Answers

they can impact your life by always having someone to count on and that really just makes you happy

Whatever you post online—whether a silly picture, angry comment, or sharing about a chronic illness—is there forever. Delete it all you want, but colleges and employers can and will find it. The discovery may give them a negative impression of you, stopping them from offering you admission or a job.

Which of the following is a proper summary of this text passage?

a
Whatever you post online is there forever. It can prevent you from getting a job.
b
According to the author, anything a person posts on the Internet "is there forever."
c
What a person posts online can follow them forever and negatively affect his or her future.
d
Posting personal information online, such as pictures and thoughts, cannot be permanently deleted. Others could find it, which can affect career or school options even years into the future.

Answers

Answer:

B "According to the author, anything a person posts on the Internet "is there forever."

Explanation:

I am not entirely sure but I think its option d. I hope I helped.

According to the reading selection, "Critter Calculations: Animal Math," when primates showed the ability to distinguish between more or less of something, at which number were they no longer able to distinguish between amounts?
a.
at four or more objects
c.
at eight or more objects
b.
at two or more objects
d.
at five or more objects
right answer will give brainliest

Answers

Answer:

A at four or more objects

Explanation:

Im sorry but Quizlet

The answer is A at four or more object because the amount of the reading selection is four

Write a poem about your best friend.

Answers

Answer:You are my best friend; you belong in my heart.

We go through ups and downs, but still nothing can tear us apart.

I know you as a sister, and I will always care.

Love, respect, and trust are the things we share.

I know you as a person; I especially know you as a friend.

Our friendship is something that will never end.

Right now, this second, this minute, this day,

Our sisterhood is here, is here to stay.

My friendship with you is special and true.

When we are together, we stick like glue.

When I'm in the darkness that needs some light,

When you're by my side, I know things are all right.

Our friendship is so strong; it breaks down bars.

Our friendship is also bright, like the sun and the stars.

If we were in a competition for friendships, we would get a gold,

Because responsibility and cleverness are the keys we hold.

I met you as a stranger, took you as a friend.

I hope our long friendship will never end.

Our friendship is like a magnet; it pulls us together,

Because no matter where we are, our friendship will last forever!

02.10 Kick It Up a Notch

PLZ DO THE REVISED PARAGRAPH AND THE REFLECTION

IF YOU DONT KNOW HOW TO DO THIS DONT ANSWER THE QUESTION U WILL BE REPORTED IF U DO

_________________________________________________________

You will revise one body paragraph from your informational article and write a reflection paragraph in which you explain the revisions you made.
View the grading rubric as you complete your work. This is your guide to a super submission.
Choose one body paragraph from your informational article to revise.
Copy this paragraph into a new document.
Review your paragraph for coherence. Make sure you have a topic sentence and supporting ideas for this topic.
Combine two or more sentences in your paragraph for varied syntax.
Review your paragraph for correct English language conventions. Correct any errors. Write a short reflection paragraph on the revisions you made, describing the changes you made and how these changes improve your writing.
the original paragraph
the revised paragraph
the reflection on the changes you have made
_________________________________________________________

original paragraph-
Have you ever seen a vulture before? Well even if you haven’t you have most likely seen an image of the bald creature. These birds feed of dead animal’s carcasses, making them ‘’a necessary and positive part of nature,’’ says M.E White, author of ‘’Vultures make life difficult’’.
These birds have inflicted damage on neighborhoods by, destroying car’s paint, nib
bling the wheels, and chewing the caulking on the windows. Putting a stop to their
detriment to peoples properties is crucial. Putting up deterrents and even contacting the U.S Wildlife Service are options to help stop these vultures from causing
more damage to our homes.


revised paragraph-




reflection-

Answers

Answer:

These birds have inflicted damage on neighborhoods by, destroying car’s paint, nibbling the wheels, and chewing the caulking on the windows. Putting a stop to their detriment to peoples properties is crucial. Putting up deterrents and even contacting the U.S Wildlife Service are options to help stop these vultures from causing more damage to our homes.

Explanation:

i need points for nother qusition. plz dont report me :| i will get an F on my quiz i i cant ak this qusition

Answer:

These birds have inflicted damage on neighborhoods by, destroying car’s paint, nibbling the wheels, and chewing the caulking on the windows. Putting a stop to their detriment to peoples properties is crucial. Putting up deterrents and even contacting the U.S Wildlife Service are options to help stop these vultures from causing more damage to our homes.

Explanation:

Final Question for everyone wondering, Identify one type of rhetorical devices used in paragraph and what sentence is it?

This is a great honor for me. Someday I want you children out there to have that great honor too. And we know that that time is not someday. We know that that time is now. I thank you, and may god bless you. And may He continue to bless you long after I am gone.

Answers

Answer:

Pathos

Explanation:

The author or speaker is appealing to their audience's emotions and their own.

Pathos ya Pathos It's Pathos
Other Questions
Complete the analogyREBEL : ORTHODOXY :: (A) nonconformist : convention(B) radical : revolution (C) soldier : combat (D) scientist : theory Which statement illustrates bias in scientific research?A zoologist publishes incomplete data on sloths which supports their original hypothesis and notes that more research is required.A botanist publishes data about plant growth that does not support their original hypothesis and is replicable.An ecologist publishes data funded by a construction company which supports their original hypothesis that an endangered animal's territory is not endangered.A microbiologist publishes data funded by the National Institutes of Health that does not support their original hypothesis. Help me please!!! I need a short letter, using basic or simple teems, words, vocabulary. I would like to be Cabinet member perspective. But Natives is also fine with me. Thanks. Please need help Choose the words that complete the following sentence.Direct quotes needaround them, or else it is considered(1 point)O quotation marks/summarizingO quotation marks/plagiarismO parentheses/summarizingO parentheses/plagiarism I love you. You are worth it. What does this quote mean? Thanks! Ayala is making salad dressing. She mixes oil andvinegar in a blender until a smooth consistency isformed. Explain whether this is a heterogeneous or ahomogeneous mixture and why. Help?Jessica must determine how many packages of cookies and cupcakes to buy for her family reunion. Jessica's mother has asked her to buy the same number of each type of item but no more than 100 of each. At the bakery, Jessica finds that cookies are sold in packages of 12 and cupcakes are sold in packages of 9.Use the drop-down menus to select the answers that make each statement true.The greatest number of packages that Jessica can buy is _ packages of cookies and _ packages of cupcakes. explain what happens when particles collide When a story is told from the _____, the narrator has full knowledge of all the characters. omniscient third-person point of view reliable first-person point of view unreliable first-person point of view limited third-person point of view The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut a student performed an experiment, using a cocktail peanut, before it was burned the peanut half weighed .353 g. After burning the residue weighed .016 g. The energy released by the conjunction increased the temperature of 200. mL of water in the calorimeter by 7.2 degrees Celsius. Calculate the mass of peanut consumed in the combustion. twice the sum of k and 9 is 4 The product of a number and -5 is at least 35. Write as an inequality. who killed the district judge during the revolutionary movementanswer in one sentence Quick question for you all People who complain that video games involve too much sitting are probably old. They probably dont know very much about gaming, either. They dont realize that people can play virtual sports, such as tennis, on video games. There are video games for dancing, too. If people bothered to learn about the different kinds of video games, they would see how wrong they are. This students sample paragraph addresses the counterclaim. Critique this paragraph by answering the questions.What is the counterclaim?Video games are too violent.Video games make people inactive.Video games are different today.What evidence weakens the counterclaim?People who complain are old.Sitting too much is bad for people.There are video games for sports and dancing.What is the tone of the rebuttal?respectfulrudehumorous Mention the type of seeds that undergo hypogeal germination.What do we call the process of permanently stopping babies from breast feeding?plzz help it is due today