The factors of two numbers are given below: Number 1: 1, 3, 5, 7, 15, 21, 35, 105. Number 2: 1, 3, 7, 21, 49, 147. What is the greatest common factor of the numbers

The Factors Of Two Numbers Are Given Below: Number 1: 1, 3, 5, 7, 15, 21, 35, 105. Number 2: 1, 3, 7,

Answers

Answer 1

Answer:

21

Step-by-step explanation:

they both have 21


Related Questions

Refer to the accompanying data set and construct a ​% confidence interval estimate of the mean pulse rate of adult​ females; then do the same for adult males. Compare the results. Click the icon to view the pulse rates for adult females and adult males. Construct a ​% confidence interval of the mean pulse rate for adult females. nothing bpm nothing bpm ​(Round to one decimal place as​ needed.) Construct a ​% confidence interval of the mean pulse rate for adult males. nothing bpm nothing bpm ​(Round to one decimal place as​ needed.) Compare the results.
A. The confidence intervals​ overlap, so it appears that there is no significant difference in mean pulse rates between adult females and adult males.
B. The confidence intervals​ overlap, so it appears that adult males have a significantly higher mean pulse rate than adult females.
C. The confidence intervals do not​ overlap, so it appears that adult females have a significantly higher mean pulse rate than adult males.
D. The confidence intervals do not​ overlap, so it appears that there is no significant difference in mean pulse rates between adult females and adult males.

Answers

Complete Question

The complete question is shown on the first uploaded image

Answer:

The 95% confidence interval of mean pulse rate for adult female is [tex]71.98 <  \mu <  79.88 [/tex]

The 95% confidence interval of mean pulse rate for adult male is  [tex]62.89 <  \mu <  70.57 [/tex]

The correct option is  C

Step-by-step explanation:

  Generally the sample mean for Male pulse rate is mathematically represented as

       [tex]\= x_1 = \frac{\sum x_i }{n}[/tex]

= >    [tex]\= x_1 = \frac{81 + 74 + \cdots + 59 }{40 }[/tex]

= >    [tex]\= x_1 = 66.73[/tex]

Generally the standard deviation for male pulse rate is mathematically represented as

      [tex]\sigma_1 = \sqrt{\frac{\sum (x - \= x)^2 }{n-1 } }[/tex]

=>   [tex]\sigma_1 = \sqrt{\frac{\sum (81 - 66.73 )^2 + (74 - 66.73 )^2+ \cdot + (59 - 66.73 )^2 }{40-1 } }[/tex]

=>   [tex]\sigma_1 = 12.24[/tex]

From the question we are told the confidence level is  95% , hence the level of significance is    

      [tex]\alpha = (100 - 95 ) \%[/tex]

=>   [tex]\alpha = 0.05[/tex]

Generally from the normal distribution table the critical value  of  [tex]\frac{\alpha }{2}[/tex] is  

   [tex]Z_{\frac{\alpha }{2} } =  1.96[/tex]

Generally the margin of error is mathematically represented as  

      [tex]E = Z_{\frac{\alpha }{2} } *  \frac{\sigma_1 }{\sqrt{n} }[/tex]

=>    [tex]E = 1.96 *  \frac{12.4 }{\sqrt{40} }[/tex]

=>    [tex]E =3.84 [/tex]

Generally 95% confidence interval is mathematically represented as  

      [tex]\= x_1 -E <  \mu <  \=x_1  +E[/tex]

=>    [tex]66.73 -3.84 <  \mu < 66.73 +3.84 [/tex]

=>    [tex]62.89 <  \mu <  70.57 [/tex]

  Generally the sample mean for Female pulse rate is mathematically represented as

       [tex]\= x_2 = \frac{\sum x_i }{n}[/tex]

= >    [tex]\= x_2 = \frac{81 + 94 + \cdots + 73 }{40 }[/tex]

= >    [tex]\= x_2 = 75.93[/tex]

Generally the standard deviation for Female  pulse rate is mathematically represented as

      [tex]\sigma_2 = \sqrt{\frac{\sum (x - \= x)^2 }{n-1 } }[/tex]

=>   [tex]\sigma_2 = \sqrt{\frac{\sum (81 - 66.73 )^2 + (94 - 66.73 )^2+ \cdot + (73 - 66.73 )^2 }{40 } }[/tex]

=>   [tex]\sigma_2 = 12.73[/tex]

Generally from the normal distribution table the critical value  of  [tex]\frac{\alpha }{2}[/tex] is  

   [tex]Z_{\frac{\alpha }{2} } =  1.96[/tex]

Generally the margin of error is mathematically represented as  

      [tex]E = Z_{\frac{\alpha }{2} } *  \frac{\sigma_2 }{\sqrt{n} }[/tex]

=>    [tex]E = 1.96 *  \frac{12.73 }{\sqrt{40} }[/tex]

=>    [tex]E =3.95 [/tex]

Generally 95% confidence interval is mathematically represented as  

      [tex]\= x_2 -E <  \mu <  \=x_2  +E[/tex]

=>    [tex]75.93 -3.95 <  \mu < 75.93 + 3.95 [/tex]

=>    [tex]71.98 <  \mu <  79.88 [/tex]

i Wnte 2x2x3x3x5 using exponents.​

Answers

Answer: 2^2 x 3^2 x 5

Find the whole, given the part and the percent. 50% of what number is 60​

Answers

Answer:

50% of 120 is 60

Step-by-step explanation:

So 60 is half of 120, and 60 times 2 is 50 :)

(Brainliest?)

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

Let x as that number ,

So :

[tex] \frac{50}{100} x = 60 \\ [/tex]

[tex] \frac{1}{2} x = 60 \\ [/tex]

Multiply sides by 2

[tex]2 \times \frac{1}{2} x = 2 \times 60 \\ [/tex]

[tex]x = 120[/tex]

Thus that number is 120 .

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

Which expression represents 4 less than twice a number, n?

Answers

Answer:

x = 2n - 4

Step-by-step explanation:

hope this helped have a great day

The answer is y=x^2-4

your class is having a car wash for a fundraiser. it costs $27.95 for supplies. your class charges $5 per car. write an expression for the profit of the car. find the profit if the class washes 34 cars.​

Answers

Equation y = 5x - 27.95
Plug in 34 for x
5(34) - 27.95
170 - 27.95 = $142.05

Answer:

5x-27.95=profit

5(34)-27.95

170-27.95

$142.05

PLEASE HELP ASAP 80 POINTS!!!!

Theresa volunteers at a food sheif. when she started, there were 213 oranges. After filling X bags of three oranges each, there were fewer than 51 oranges left. How many bags of oranges did Theresa fill?

Write an expression in terms of X for the number of oranges that Theresa bagged.

Part B: Write an expression in terms of X for the number of oranges that are left (have yet to be bagged).

Part C: Write an inequality using the expression from Part B to represent this scenario.

Part D: Solve the inequality for the variable X. Use opposite operations on both sides of the inequality until you get X on one side of the inequality by itself.

Part E: Did you have to flip the inequality sign? Explain why or why not.

Part F: What does the result from Part D tell you about Theresa's situation? Does the answer make sense? Explain.

Part G: Think about graphing the inequality you found in Part D on a number line. What would it look like?

Choose the correct number:

1. open circle on 54 and arrow pointing right
2. open circle on 54 and arrow pointing left
3. closed circle on 54 in arrow pointing right
4. closed circle on 54 and arrow pointing left​

Answers

Answer:

A- The expression 3x represents the number of oranges that she bagged

B-  213 − 3x (or -3x + 213)

C- 213 − 3x < 51 (or -3x + 213 < 51)

D- x >54

E-Yes, I had to flip the inequality sign because I divided both sides of the inequality by a negative number (-3).

F- x > 54 means Theresa filled more than 54 bags of oranges. It makes sense because if Theresa made more than 54 bags of 3 oranges each, there would be fewer than 51 oranges left over.

G- Number 1 is correct.

Step-by-step explanation:

I did it./ Hope it helped : )

Answer:

everyone mark Praezhan brainleist thank you Praezhan so much

Step-by-step explanation:

Which of the following is a postulate or theorem used to prove two triangles are congruent? ASA SSS AAA SAS

Answers

9514 1404 393

Answer:

  ASA, SSS, SAS

Step-by-step explanation:

AAA is a postulate used to prove similarity. Congruence cannot be proved without including at least one side.

  ASA, SSS, SAS postulates can be used to prove congruence

A large tank is partially filled with 100 gallons of fluid in which 20 pounds of salt is dissolved. Brine containing 1 2 pound of salt per gallon is pumped into the tank at a rate of 6 gal/min. The well-mixed solution is then pumped out at a slower rate of 4 gal/min. Find the number of pounds of salt in the tank after 35 minutes.

Answers

Answer:

Step-by-step explanation:

From the given information:

[tex]R_{in} = ( \dfrac{1}{2} \ lb/gal) (6)\ gal /min \\ \\R_{in} = 3 \ lb/min[/tex]

Given that the solution is pumped at a slower rate of 4gal/min

Then:

[tex]R_{out} = \dfrac{4A}{100+(6-4)t}[/tex]

[tex]R_{out}= \dfrac{2A}{50+t}[/tex]

The differential equation can be expressed as:

[tex]\dfrac{dA}{dt}+ \dfrac{2}{50+t}A = 3 \ \ \ ... (1)[/tex]

Integrating the linear differential equation; we have::

[tex]\int_c \dfrac{2}{50 +t}dt = e^{2In |50+t|[/tex]

[tex]\int_c \dfrac{2}{50 +t}dt = (50+t)^2[/tex]

multiplying above integrating factor fields; we have:

[tex](50 +t)^2 \dfrac{dA}{dt} + 2 (50 + t)A = 3 (50 +t)^2[/tex]

[tex]\dfrac{d}{dt}\bigg [ (50 +t)^2 A \bigg ] = 3 (50 +t)^2[/tex]

[tex](50 + t)^2 A = (50 + t)^3+c[/tex]

A = (50 + t) + c(50 + t)²

Using the given conditions:

A(0) = 20

⇒ 20 = 50 + c (50)⁻²

-30 = c(50) ⁻²

c = -30 × 2500

c =  -75000

A = (50+t) - 75000(50 + t)⁻²

The no. of pounds of salt in the tank after 35 minutes is:

A(35) = (50 + 35) - 75000(50 + 35)⁻²

A(35) = 85 - [tex]\dfrac{75000}{7225}[/tex]

A(35) =69.6193 pounds

A(35) [tex]\simeq[/tex] 70 pounds

Thus; the number of pounds of salt in the tank after 35 minutes is 70 pounds.

Someone please help ASAP!!!!

Answers

Answer:

3/5 = 6/10, which is 0.6 in decimal form

PLEASE HELP!!!!

IT IS NOT A

A. Yes; 20 hours/painter

B. Yes; 8 hours/painter

C. No; Does not pass through the origin

D. None of the above

Answers

Answer:

C

Step-by-step explanation:

Answer:

Pretty sure it's

D. None of the above

what is the constant of porportionality between 9 and 4.5​

Answers

Answer:

1/2

Step-by-step explanation:

the number in unit form is all mixed up convert it tostandard form

Answers

Answer:

Step-by-step explanation:

What number?

Vocabulary How can you tell when an equation in one variable has infinitely many solutions or no solution? When you solve for the variable, you will end up with a true statement, like 2 = 2, for an equation with no solution. You also will end up with a true statement for an equation with infinitely many solutions. When you solve for the variable, you will end up with a false statement, like 0 = 2, for an equation with no solution. You will also end up with a false statement for an equation with infinitely many solutions. When you solve for the variable, you will end up with a false statement, like 0 = 2, for an equation with no solution. You will end up with a true statement, like 2 = 2 for an equation with infinitely many solutions. When you solve for the variable, you will end up with a true statement, like 2 = 2, for an equation with no solution. You will end up with a false statement, like 0 = 2 for an equation with infinitely many solutions.

Answers

Answer: Choice C) When you solve for the variable, you will end up with a false statement, like 0 = 2, for an equation with no solution. You will end up with a true statement, like 2 = 2 for an equation with infinitely many solutions.

For example, let's say we had the equation x = x+2. Subtracting x from both sides leads to 0 = 2 which is a false statement. No matter what we replace x with, the equation x = x+2 is always false. That's why we don't have any solutions here.

For an equation like x + 2 = x + 2, subtracting x from both sides leads to 2 = 2 which is always true. A true equation is one where the same number is on both sides. No matter what we replace x with, the equation will be true. Therefore, there are infinitely many solutions.

To tell when an equation in one variable has infinitely many solutions or no solution;

When you solve for the variable, you will end up with a false statement, like 0 = 2, for an equation with no solution.

You will end up with a true statement, like 2 = 2 for an equation with infinitely many solutions.

The condition for an equation with no solution warrants that the equation upon evaluation yields a false statement as in the case of 1 = 2. In this case, such an equation has no solution.

The condition for an equation with infinitely many solutions warrants that the equation upon evaluation yields a true statement as in the case of y + 5 = y + 5. In this case, such an equation has infinitely many solution.

Read more;

https://brainly.com/question/11966980

The product of two consecutive even integers is 2208. What is their sum?

Answers

Answer:

±94

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDASEquality Properties

Algebra I

Standard Form: ax² + bx + c = 0Solving Quadratic EquationsConsecutive Integers

Step-by-step explanation:

Step 1: Define

x  (1st consecutive term)

x + 2 (2nd consecutive term)

Step 2: Set up equation

x(x + 2) = 2208

Step 3: Solve for x

Distribute x:                                   x² + 2x = 2208Rewrite in Standard Form:           x² + 2x - 2208 = 0Factor quadratic:                          (x - 46)(x + 48) = 0Find roots:                                     x = -48, 46

Step 4: Identify Consecutive Integers

Possibility 1: x = -48

1st Consecutive Even Term: -48

2nd Consecutive Even Term: -48 + 2 = -46

Possibility 2: x = 46

1st Consecutive Even Term: 46

2nd Consecutive Even Term: 46 + 2 = 48

Step 5: Find sums

Possibility 1: x = -48

-48 + -46 = -94

Possibility 2: x = 46

46 + 48 = 94

A car travels 1295 feet in 5 seconds. How far can the car travel in 50 seconds?

Answers

Answer:

12950

Step-by-step explanation:

A quadrilateral has no pairs of parallel sides, what two shapes could it be?

Answers

Answer:

Kite

Step-by-step explanation:

Def of kite has no parallel sides

Answer:

Kite and Trapezium

Step-by-step explanation:

Each of them do not have any parallel lines or sides

Select the correct answers in the table.
Rachel enjoys exercising outdoors. Today she walked 5 2/3 miles in 2 2/3hours. What is Rachel’s unit walking rate in miles per hour and in hours per mile?
A.) 2 1/8
B.) 2 4/9
C.) 8/17
D.) 3 1/8

Note: there hours and miles, but you have to give two answers, one for miles one for hours THANKS XD lolol <3

Answers

Answer:

b

Step-by-step explanation:

Find the distance of a line given the following points. R(3, 1), W(-1, -2)

Answers

Answer:

[tex]\sqrt{13}[/tex]

Step-by-step explanation:

we can solve this using the distance formula: [tex]\sqrt{(x_{2}-x_1)^{2} + (y_{2}-y_1)^{2}}[/tex]

[tex]x_1, y_1[/tex] is (3, 1)

[tex]x_2, y_2[/tex] is (-1, -2)

[tex]\sqrt{(1-3)^2 + (-2-1)^2}[/tex]

which simplifies to: [tex]\sqrt{(-2)^2 + (-3)^2}[/tex]

then: [tex]\sqrt{2^2 + 3^2}[/tex] or: [tex]\sqrt{4+9}[/tex]

your final answer is: [tex]\sqrt{13}[/tex] or about 3.61

juanito has a rope 1.75 meters long. He needs to cut it into shorter ropes each 0.1 meter long​

Answers

Answer:

17.5

Step-by-step explanation:

[tex]1.75 \div 0.1 = 17.5[/tex]

Use the tape diagram to write an equivalent ratio in simplest form. Write your ratio using a colon and no spaces.

Answers

Answer:

4:3

Step-by-step explanation:

There are 8 yellow spots and 6 blue spots

8:6

We can divide each side by 2 since they are both even

8/2: 6/2

4:3

Answer:

4:3

Step-by-step explanation:

Which phrases can be represented by the expression 60w?

Answers

The product of 60 and a number and sixty times a number.

The answer is 60 plz correct me

Let A represent reading newspaper and represent watching television
Which statement is true?
Watching television and and reading newspaper are independent events because P(AB) + P(A) and
PBAP(B)
Watching television and reading newspaper are not independent events because P(AB)=P(A) and
P(BA) - P(B)
Watching television and reading newspaper are independent events because P(AB) = P(A) and P(BA) = P(B).
Watching television and reading newspaper are not independent events because P(AB) + P(A) and
P(BA) = P(B)
Lo

Answers

Answer:

in the picture

Step-by-step explanation:

How to solve (10 points)

Answers

Answer:

side 1: 10 = 15

side 2: 6 = 11

im not 100% sure this is correct

Step-by-step explanation:

13-8 = 5

so we add 5 on each side

10 + 5 = 15

6 + 5 = 11

please help this is so confusing!!!

Answers

Answer:

$16.50 on 3 bags of dog food

Step-by-step explanation:

First you would do 27.50/5 to find out how much one bag costs.

The symbol  /  mean to divide. So 27.50 divided by 5 is 5.50. We need to know the ammount of 3 bags. Hence, we evaluate 3 times 5.50 which equals to our answer, $16.50 on 3 bags of dog food. I hope this will help you succeed!

Please help with my homework

Answers

It's 65. Because you add the other angles and get 90+25 and get 115. 180 -115 = 65.

Answer:

c=65°

Step-by-step explanation:

180-90=90

90-25=65

hopefully this helps :)

how to math pls i ned to math

Answers

Answer:

8 inches

Solution:

First, you need to add all sides which will give you 147. Then, to find the length of GA, you need to subtract the perimeter which is 167, by 147 which will give you 20. GA = 20

Thus to find G'A', you need to cross multiply 14/35 = G'A'/20

You should end up with 280 = 35. Divide 35 by 280 and you get 8.

PLEASE MARK IT AS BRAINLIEST

Answer:

2+2=4-1+3

Step-by-step explanation:

quick mafs

helppppp please I will give brainliest​

Answers

Answer:

-3/4

Step-by-step explanation:

Answer:

B. 4/3

Step-by-step explanation:

The slope is rise over run or the change in y over the change in x. To find the slope count how many units y increases by then divide that by how many units x increases. In this graph y goes up by 4 and x increases by 3, so 4/3. Another way to find slope is the slope formula which is [tex]\frac{y_{2}-y_{1} }{x_{2}-x_{1} }[/tex], then plug in any two points and solve them.

need help somebody pleaseee

Answers

Answer:

The second one I believe

What is 3/5 plus 4/8

Answers

Answer: 11/10 is your answer

Step-by-step explanation: Hoped this helped

Answer:

1.1

Step-by-step explanation:

3/5 + 4/8 = 1.1

One number is four times the other number. The larger number is also 87 more than the smaller number.
Find the larger number.

Answers

Answer:

116

Step-by-step explanation:

Let numbers be x and y

Then we have equations:

x = 4yx = y + 87

Comparing

4y = y + 874y - y = 873y = 87y = 87/3y = 29

Then, the larger number is

x = 4*29 = 116
Other Questions
The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut a student performed an experiment, using a cocktail peanut, before it was burned the peanut half weighed .353 g. After burning the residue weighed .016 g. The energy released by the conjunction increased the temperature of 200. mL of water in the calorimeter by 7.2 degrees Celsius. Calculate the mass of peanut consumed in the combustion. twice the sum of k and 9 is 4 The product of a number and -5 is at least 35. Write as an inequality. who killed the district judge during the revolutionary movementanswer in one sentence Quick question for you all People who complain that video games involve too much sitting are probably old. They probably dont know very much about gaming, either. They dont realize that people can play virtual sports, such as tennis, on video games. There are video games for dancing, too. If people bothered to learn about the different kinds of video games, they would see how wrong they are. This students sample paragraph addresses the counterclaim. Critique this paragraph by answering the questions.What is the counterclaim?Video games are too violent.Video games make people inactive.Video games are different today.What evidence weakens the counterclaim?People who complain are old.Sitting too much is bad for people.There are video games for sports and dancing.What is the tone of the rebuttal?respectfulrudehumorous Mention the type of seeds that undergo hypogeal germination.What do we call the process of permanently stopping babies from breast feeding?plzz help it is due today 2) look closely at article XLVII. Rephrase it in your own words. How do you think this impacted the unity among slaves during the revolution?Please I need help! Use the interactive tool to graph the line given the following information: coordinates (1,3) slope of 2Based on your investigation, what is the value of b for the point (0,b)? what is carbogen and it's uses Please help!!!! ASAP!!! Thank you!!! Brainliest to right answer also based on answer 1 are the equations equivalent? help will give brainlyist and 5 star and heart (MC)Read the narrative and determine the point of view:"As you walked along the beach with your mom, you knew it was time to tell her the facts about what happened. She may never pardon you for your deceit, but you sense that she deserves to know. You think that to regain her trust, you need to demonstrate responsibility now for what you did and be honest about it." (5 points) aFirst person bSecond person cThird-person limited dThird-person objective eThird-person omniscient Why did the results of the presidential election of 1867 anger many democrats What percentage of the population of the colonies were patriots slausonn can you pls answer this quesion pls i have 3 min left