The Toyota Mirai is a prime example of advanced technology. However, there are no refueling stations available or planned in the Midwest, so to someone in Michigan, the Mirai would be a poor purchase. This is an example ofa) quality being defined by the buyer.b) poorly designed technology.c) the market not wanting advances in technology.d) a product designed for all markets.e) a product being of low-quality

Answers

Answer 1

Answer:

The correct answer is the option C: the market not wanting advances in technology.

Explanation:

To begin with, the fact that the new product is an example of advanced technology it does not exactly engages in the fact that it will work in every market that it will be launched. That is the example presented in the case, the new product is so good but the market where it launched it was not ready yet for its arrival and that is because it did not have the refueling stations so that implicates that if there are not those stations then the demand of that type of cars is not enough and therefore the market is not wanting that kind of advances in technology so that is why that to someone in Michigan the Mirai would be a poor purchase.


Related Questions

Analyze how Nintendo recreated the home video game business following the Atari-era boom and bust. How was Nintendo able to capture value in the home video game business?

Answers

Answer: Cost leadership and differenciation in quality

Explanation:

Cost leadership; Nitendo was able to reduce production cost by subcontracting most of it's production, while the rest of it's production were done within(in-house), with this effect in cost of production reduced, Nitendo was able to reduce selling price and beat the competition in the market.

Differentiation in quality; Nintendo came with quality, their graphics and sounds were top-notch, despite that, they still invested more in main them better with better technology innovation.

Consider the following information about an asset that is being review for impairment: Book value $ 700,000 Estimate future cash flows 650,000 Fair value 590,000 What is the amount of the impairment loss for this asset?

Answers

Answer:

The amount of the impairment loss for this asset is $110,000

Explanation:

A assets is impaired when the fair market value of that assets lowers than the book value of the asset.

To calculate the impairment of an assets following formula is used

Impairent = Book value of Asset -  fair market value of the asset

Placing values in the formula

Impairent = $700,000 -  $590,000

Impairent = $110,000

The comparative financial statements prepared at December 31, 2015, for Prince Company showed the following summarized data:
2015 2014
Income statement
Sales Revenue 190,900 167,300
Cost of goods sold 113,000 102,000
Gross Profit 77,900 65,300
Operating expenses and interest expense 56,700 53,700
Pretax income 21,200 11,600
Income Tax 6,200 3,100
Net Income 15,000 8,500
Balance Sheet
Cash 4,600 6,500
Accounts Receivable (net) 15,300 16,900
Inventory 40,300 32,600
Operational Assets (net) 46,400 36,400
106,600 92,400
Current liabilities (no interest) 15,100 16,100
Long-term liabilities (10%interest) 44,900 44,900
Common Stock (par $5) 29,900 29,900
Retained Earnings 16,700 1,500
106,600 92,400
1. Present component percentages for 2015 only.
2. Respond to the following for 2015:
What was the gross profit percentage?

Answers

Answer:

Prince Company

1. Component percentages for 2015:

Income statement              2015      Percentage

Sales Revenue             190,900          100%

Cost of goods sold       113,000            59% (113,000/190,900 * 100)      

Gross Profit                    77,900             41% (77,900/190,900 * 100)

Operating expenses and

interest expense         56,700             30% (56,700/190,900 * 100)            

Pretax income               21,200              11% (21,200/190,900 * 100)

Income Tax                     6,200               3% (6,200/190,900 * 100)

Net Income                   15,000               8% (15,000/190,900 * 100)  

Balance Sheet                                   2015      Percentage

Cash                                                 $4,600     4.3% (4,600/106,600 * 100)  

Accounts Receivable (net)               15,300    14.4% (15,300/106,600 * 100)    

Inventory                                          40,300    37.8% (40,300/106,600 * 100)    

Operational Assets (net)                 46,400    43.5% (46,400/106,600 * 100)

Total                                               106,600    100%    

Current liabilities (no interest)        15,100       14.2% (15,100/106,600 * 100)  

Long-term liabilities (10%interest) 44,900      42.1% (44,900/106,600 * 100)

Common Stock (par $5)               29,900        28% (29,900/106,600 * 100)  

Retained Earnings                         16,700        15.7% (16,700/106,600 * 100)  

Total                                            106,600       100%  

2. Gross profit percentage for 2015:   41%

Explanation:

a) Data and Calculations:

Income statement              2015           2014

Sales Revenue             190,900      167,300

Cost of goods sold       113,000      102,000

Gross Profit                    77,900       65,300

Operating expenses and

interest expense         56,700        53,700

Pretax income               21,200         11,600

Income Tax                     6,200          3,100

Net Income                   15,000         8,500

Balance Sheet

Cash                                                 $4,600    $6,500

Accounts Receivable (net)               15,300     16,900

Inventory                                          40,300    32,600

Operational Assets (net)                 46,400    36,400

Total                                               106,600    92,400

Current liabilities (no interest)        15,100      16,100

Long-term liabilities (10%interest) 44,900    44,900

Common Stock (par $5)               29,900    29,900

Retained Earnings                         16,700        1,500

Total                                            106,600     92,400

Toys "R" Us has decreased its receivable turnover over the last three years: which of the following may be a possible cause of this decrease? A) the company has been more selective in choosing reliable customers. B) salesmen have granted customers an extension of credit terms. C) the accounting department has increased the allowance for doubtful accounts. D) all of the above are correct

Answers

Answer:

B) salesmen have granted customers an extension of credit terms.

Explanation:

receivables turnover ratio = net sales / average accounts receivable

A low receivables turnover ratio is usually a bad thing, since most companies sell on credit, i.e. their accounts receivable should be important. A high receivables turnover ratio means that the company is collecting its accounts receivable efficiently and its customers are good payers.

The key point here is average accounts receivable. What can result in a company having very high accounts receivable (compared to its total sales)? The answer is simple, their customers are not paying on time or the company had to extend their credit terms in order to attract more customers.

Megans personal information is shown below according to the following table what is her hypothetical credit score

Answers

Answer: Sherry's credit score is 390

Explanation:

You did not include Megan's details so I used a reference question and you can answer with your details looking at how I answered this one.

Sherry personal information is shown below . age 26 .time of address 3 years .age of auto 9 years .car payment none. Housing cost 750 .checking and saving accounts checking only . Finance company reference no . Major credits cards 4 .ratio of debt to income 22% . Declared bankruptcy never .according to the following table what is her credit score

                                                    Option Points       Allocated based on table

Age                                                        26                               20

Time of address                                     3                                20

Age of Auto                                            9                                  0

Car Payment                                        None                            72

Housing Cost                                       750                              48

Checking and Saving accounts    Checking only                    8

Finance company reference                No                               60

Major credits cards                               4                                 60

Ratio of debt to income                       22%                               0

Declared bankruptcy                        Never                            102

Total                                                                                         390

Ten years ago, Lucas Inc. earned $0.50 per share. Its earnings this year were $5.00. What was the growth rate in earnings per share (EPS) over the 10-year period?

Answers

Answer:

25.89%

Explanation:

With regards to the above information, initial earning = $0.50

Final earnings = $5.0

Number of periods = 10 years

We can formulate the above into an equation, which will now be:

$5.00 = $0.5 ( 1 + rate )^ 10

We can simplify furthermore.

1 + rate ^ 10 = 5 / 0.5

1 + rate ^ 10 = 10

1 + rate ^ 10 = 10^1/10

1 + rate = 10 ^ 0.1

1 t rate = 1.2589

rate = 1.2589 - 1

rate = 0.2589

rate = 25.89%

Therefore, the growth rate in earnings per share (EPS) over the 10 year period is 25.89% .

Casey Electronics has a piece of machinery that costs $300,000 and is expected to have a useful life of 6 years or 40,000 hours. Residual value is expected to be $50,000.Using the units-of-production method, what is depreciation expense for the first year assuming it was used 6,000 hours?a) $37,500b) $70,000c) $81,000d) $41,667

Answers

Answer:

a) $37,500

Explanation:

In order to determine the depreciation for year 1  based on the units-of-production method, we apply the formula below:

Annual Depreciation= Depreciable Value × Units produced during the year /Estimated total production

Depreciable Value = Original cost – Scrap value

depreciable value=$300,000-$50,000=$250,000

Units produced during the year=6,000 hours

Estimated total production in hours=40,000 hours

first-year depreciation=$250,000*6000/40000

first-year depreciation=$ 37,500.00  

For Flynn Company, variable costs are 70% of sales, and fixed costs are $195,000. Management’s net income goal is $75,000. Compute the required sales in dollars needed to achieve management’s target net income of $75,000.

Answers

Answer:

i would 75,345 is your answer

Explanation:

The required sales in dollars needed to achieve management’s target net income of $75,000 is $900,000.

Required sales in dollar

Using this formula

Required sales in dollar=Fixed cost+ Net income/ (1-percentage)

Let plug in the formula

]Required sales in dollar=$195,000+$75,000 /(1-.70)

Required sales in dollar=$270,000/.30

Required sales in dollar=$900,000

Therefore the required sales in dollars needed to achieve management’s target net income of $75,000 is $900,000.

Learn more about Required sales in dollar here:https://brainly.com/question/15079417

#SPJ9

Choi Home Repair needs to accumulate $22,000 in 6 years to purchase new equipment. What sinking fund payment (in $) would they need to make at the end of each three months, at 4% interest compounded quarterly?

Answers

Answer: $815.62

Explanation:

This is an annuity because it is to be a specific payment per period.

As it is in 6 years, it is a Future Value calculation.

Number of periods = 6 years * 4 quarters = 24 quarters

Interest = 4%/ 4 quarters = 1%

Future Value = Annuity * Future Value interest factor of Annuity, 24 periods, 1%

22,000 = Annuity * 26.9735

Annuity = 22,000/26.9735

Annuity = $815.62

which fiscal policy would most likely result in the largest budget deficit

Answers

Answer:

If the question asks for the largest SURPLUS the answer will be

High Taxation and Low Spending

Explanation:

There are two different questions make sure you read it correctly!!!!

The fiscal policy that would most likely result in the largest budget deficit is expansionary fiscal policy.

What is fiscal policy?

Fiscal policy refers to the use of the government budget to affect the economy. This includes government spending and levied taxes. The policy is said to be expansionary when the government spends more on budget items such as infrastructure or when taxes are lowered.

Such policies are typically used to boost productivity and the economy. Conversely, the policy is contractionary when government spending decreases or taxes rise. Contractionary policies might be used to combat rising inflation. Generally, expansionary policy leads to higher budget deficits, and contractionary policy reduces deficits. Expansionary Policy is when governments can spend beyond their tax-based budgetary constraints by borrowing money from the private sector. The U.S. government issues Treasury Bonds to raise funds, for example.

To meet its future obligations as a debtor, the government must eventually increase tax receipts, cut spending, borrow additional funds or print more dollars.

Learn more about fiscal policy, here:

https://brainly.com/question/27250647

#SPJ3

Swifty uses the periodic inventory system. For the current month, the beginning inventory consisted of 7300 units that cost $11.00 each. During the month, the company made two purchases: 2800 units at $12.00 each and 12200 units at $12.50 each. Swifty also sold 13100 units during the month. Using the average cost method, what is the amount of cost of goods sold for the month? (Round average cost per unit to 2 decimal places, e.g. 1.48.)
1- $156545.
2- $157200.
3- $151400.
4- $163300.

Answers

Answer:

1. $156545.

Explanation:

Average cost of inventory = {(7300 x $11) + (2800 x $12) + ($12200 x $12.50)}/(7300 + 2800 + 12200)

Average cost of inventory = $80300 + $33600 + $152500)/22300

Average cost of inventory = $11.95 per unit

Cost of goods sold = Units sold * average cost per unit

Cost of goods sold = 13,100 * $11.95

Cost of goods sold = $156,545

Roland had revenues of $601,000 in March. Fixed costs in March were $212,520 and profit was $51,920. A. What was the contribution margin percentage?B. What monthly sales volume (in dollars) would be needed to break-even?
c. What sales volume (in dollars) would be needed to earn $169,420?

Answers

Answer: See explanation

Explanation:

Revenue = $601,000

Fixed costs = $212,520

Profit = $51,920

A. A. What was the contribution margin percentage?

Contribution margin will be calculated as:

= (Fixed cost + Profit) / Revenue

= ($212520 +$51920) / $601,000

= $264440 / $601000

= 44%.

B. What monthly sales volume (in dollars) would be needed to break-even?

The break even point sales will be:

= Fixed cost / Contribution margin

= $212520 / 44%

= $212520 / 0.44

= $483000

C. What sales volume (in dollars) would be needed to earn $169,420?

This will be:

= (FC+DP) / Contribution margin

= (212520 + 169420)/0.44

= $381940/0.44

= $868045.45

A formal document detailing the process to be followed when a firm recruits for an open position is a ________.a) recruiting guide.
b) staffing plan.
c) external recruiting analysis.
d) realistic job preview.

Answers

Answer:

a) recruiting guide.

Explanation:

Recruitment can be defined as an organizational process used by human resources managers to fill vacant positions existing within an organization through the acceptance of job applications from qualified candidates or applicants.

Generally, the main purpose and goal of a recruitment process is to give each and every candidate a fair opportunity, hearing and positive feelings about the recruiting organization.

A formal document detailing the process to be followed when a firm recruits for an open position is a recruiting guide. The recruitment guide is used as a laid down plan or guideline that typically identifies or highlights the goals, requirements and descriptions for each job position that is available within the organization.

A tax system in which the tax rate on everyone's first $10,000 of income is 10 percent, the tax rate on everyone's second $10,000 of income is 15 percent, and the tax rate on all income over $20,000 is 25 percent is a(n):

Answers

Answer:

The appropriate response is "Progressive tax".

Explanation:

Progressive taxation appears to mean that the tax rate is higher for increased organizations as well as lower for low-income communities. Whenever the taxable income leads to higher, the above tax rate tends to increase. The approximately equal tax rate would be taxation that is set regardless including its up or down in tax liability.

So that above is the correct answer.

Levine Inc. is considering an investment that has an expected return of 15% and a standard deviation of 10%. What is the investment's coefficient of variation?
a. 0.67
b. 0.73
c. 0.81
d. 0.89
e. 0.98

Answers

Answer:

A)0.67

Explanation:

Coefficient of variation can be regarded as the method that is usually devices in the assessment of the total risk per unit of return in a particular investment.

To calculate the investment's coefficient of variation, we use the expresion below

Coefficient of variation = standard deviation/expected return.

Given:

expected return = 15%

standard deviation = 10%.

Coefficient of variation =10/15

= 0.67

Hence, the investment's coefficient of variation is 0.67

Phillips Co. currently pays no dividend. The company is anticipating dividends of $.02, $.05, $.10, $.20, and $.30 over the next 5 years, respectively. After that, the company anticipates increasing the dividend by 3.5 percent annually. One step in computing the value of this stock today is to compute the value of:_________
a) P5.
b) P3.
c) P1.
d) P6.
e) P4.

Answers

Answer:

a) P5.

Explanation:

The formula to calculate the current price stock is as follow:

P0 = D1/(1+Ke)^1 + D2/(1+Ke)^2 + D3/(1+Ke)^3 + D4/(1+Ke)^4 + D5/(1+Ke)^5 + P5/(1+Ke)^5

The Price of share is P

The dividend is D

The required rate of return is Ke

9.
How is nominal GDP converted into real GDP?
O by eliminating the effects of price increases on GDP growth
O by adding all incomes earned to total expenditures by consumers, businesses, and government
O by adding the contributions of American-owned factories in foreign countries
O by adding up all of the real purchases made in the economy

Answers

A. By eliminating the effects of price increases on GDP growth. Nominal GDP is calculated using the current prices while Real GDP is adjusted for inflation.

Answer:

by eliminating the effects of price increases on GDP growth

Explanation:

To correct for an increase in prices, economists establish a set of constant prices by choosing one year as a base year and using this base year to calculate real GDP for other years.

Fortune Company had beginning raw materials inventory of $16,000. During the period, the company purchased $92,000 of raw materials on account. If the ending balance in raw materials was $10,000, the amount of raw materials transferred to work in process is

Answers

Answer:

The amount of raw materials transferred to work in process is $98,000.

Explanation:

Given that, at the beginning of its business operations, Fortune Company had a raw material inventory of $ 16,000 and that, during the business year, it acquired another quantity of raw materials for $ 92,000, the total of raw materials in the company's stock had a total value of $ 108,000 (16,000 + 92,000).

Now, if at the end of the balance the value of the raw materials was $ 10,000, the amount of raw material that was incorporated into the production process was a value of $ 98,000 (108,000 - 10,000).

Over a five-year period, (nominal) GDP in a nation increased from $10 trillion to $15 trillion, while the GDP price deflator increased from 100 to 125. Approximately how much is GDP in year five, stated in terms of year-one dollars?

Answers

Answer:

The GDP in year five, stated in terms of year-one dollars, is approximately $12 trillion.

Explanation:

This can be calculate using the following formula:

Real GDP in year five = Nominal GDP in year five / (GDP price deflator in year five / GDP price deflator in year-one) ................... (1)

Where;

Real GDP in year five = Amount of GDP in year five, stated in terms of year-one dollars = ?

Nominal GDP in year five = $15 trillion

GDP price deflator in year five = 125

GDP price deflator in year-one = 100

Substituting the into equation (1), we have:

Real GDP in year five = $15 / (125 / 100) = $15 / 1.25 = $12 trillion

Therefore, the GDP in year five, stated in terms of year-one dollars, is approximately $12 trillion.

Question 7 of 10
How does fractional reserve banking increase the money supply?
O A. By automatically converting foreign currencies into U.S. dollars on
deposit
O B. By guaranteeing that all deposits are held in reserve as cash at all
times
O C. By using deposited money to make loans without reducing the
value of the deposits
O D. By giving banks the authority to print their own money in an
economic emergency
SUBMIT

Answers

Answer: C. By Using deposited money to make loans without reducing the value of the deposits

Explanation:

A.P.E.X

Answer:

c

Explanation:

After graduating law school Amy has to start repaying her $110,000 in loans. Assuming the annual interest rate is 7.5% over a 20 year repayment period, what will be the monthly loan payments?

a. $886.15
b. $458.34
c. $899.18
d. $906.93

Answers

Answer:

monthly payment= $886.15

Explanation:

Giving the following information:

PV= $110,000

i= 0.075/12= 0.00625

n= 12*20= 240

To calculate the monthly payment, we need to use the following formula:

monthly payment= (PV*i) / [1 - (1+i)^(-n)]

monthly payment= (110,000*0.00625) / [1 - (1.00625^-240)]

monthly payment= $886.15

Rent expense in Volusia Company's 2016 income statement is $420,000. If Prepaid Rent was $70,000 at December 31, 2015, and is $95,000 at December 31, 2016, the cash paid for rent during 2016 is:_________

Answers

Answer:

$445,000

Explanation:

The rent in Volusian company income statement for 2016 is $420,000

The prepaid rent is $70,000 at December 31 2015 and $95,000 at December 31 2016

Therefore the cash paid for rent in 2016 can be calculated as follows

= $420,000+($95,000-$70,000)

= $420,000 + $25,000

= $445,000

According to the video, what do Financial Analysts analyze? Check all that apply.
financial records
travel distances
insurance claims
a company's competitors
fraud

Answers

A-D

-financial records

-a company’s competitors

Answer:

Financial Records

A Company’s Competitors

Explanation:

I got it right on edge 2020 hope this helps!

Colorado Rocky Cookie Company offers credit terms to its customers. At the end of 2021, accounts receivable totaled $665,000. The allowance method is used to account for uncollectible accounts. The allowance for uncollectible accounts had a credit balance of $40,000 at the beginning of 2021 and $25,000 in receivables were written off during the year as uncollectible. Also, $2,000 in cash was received in December from a customer whose account previously had been written off. The company estimates bad debts by applying a percentage of 15% to accounts receivable at the end of the year.

Required:
Prepare journal entries to record the write-off of receivables, the collection of $2,000 for previously written off receivables, and the year-end adjusting entry for bad debt expense.

Answers

Answer:

Bad debt expenses is $82,750

Explanation:

Recording the write off receivables

Date  Account Titles and Explanation                 Debit       Credit

          Allowances for uncollectible accounts   $25,000

               Accounts receivables                                              $25,000

           (To write off an uncollectible amount)

Recording the reinstatement of an account previously written off

Date  Account Titles and Explanation                 Debit       Credit

          Account receivables                                  $2,000

                 Allowances for uncollectible accounts               $2,000

          (To reinstatement of an account previously written off)

Recording collection of account previously written off

Date  Account Titles and Explanation                 Debit       Credit

          Cash                                                               $2,000

                           Account receivables                                  $2,000

          (To record the cash received)

Recording bad debt expenses for the year

Date  Account Titles and Explanation                 Debit       Credit

          Bad debt Expenses                                   $82,750

                Allowances for doubtful accounts                        $82,750

           (To record estimated bad debts)

Workings

Particulars                        Amount

Beginning balance                    $40,000

Less: Receivables write off       $25,000

Add: Collection of receivables  $2,000

        previously written off

                                                     $17,000

Less: Required allowances         $99,750 ($665,000*15%)                  

Bad debt expenses                     $82,750

Thus, the bad debt expenses is $82,750


2. Seller is defined as a party that makes, offers or contracts to make a sale to an actual or
potential buyer."
True of false? ​

Answers

Answer:

True

Explanation:

A seller is a person who agrees to exchange his goods or services with another party for money or other goods. A seller transfers ownership of the products to a buyer in exchange for money or other valuables.  It is a person who sells, a salesperson, or a vendor of goods and services.

A seller requires a buyer to complete a sales transaction.

The Greenback Store’s cost structure is dominated by variable costs with a contribution margin ratio of 0.25 and fixed costs of $40,000. Every dollar of sales contributes 25 cents toward fixed costs and profit. The cost structure of a competitor, One-Mart, is dominated by fixed costs with a higher contribution margin ratio of 0.75 and fixed costs of $440,000. Every dollar of sales contributes 75 cents toward fixed costs and profit. Both companies have sales of $800,000 for the month. Required: a. Compare the two companies’ cost structures. b. Suppose that both companies experience a 15 percent increase in sales volume. By how much would each company’s profits increase?

Answers

Answer:

                                Greenback Store            One-Mart

                                      Amount      %           Amount    %

a.  Sales                       $800,000   100%     $800,000   100%

Variable cost               $600,000    75%      $200,000    25%      

Contribution margin    $200,000    25%      $600,000    75%

Fixed cost                    $40,000       5%        $440,000    55%

Operating profit           $160,000     20%      $160,000     20%

Break even point         $160,000                  $586,666.67

Workings

Greenback Store Break even point = Fixed cost / Contribution margin ratio = 40,000 / 0.25 = 160,000

One-Mart Break even point = Fixed cost / Contribution margin ratio = 440,000 / 0.75 = 586,666.67

b. Greenback Store

Increase in sales = $800,000*15% = $120,000

Company profit Increase by + (Increase in sales * Contribution margin ratio = 120,000 * 25% = $30,000

Thus, with the increase in 15% of sales of Greenback Store, the profit of the   company increase by $30,000

One-Mart

Increase in sales = $800,000*15% = $120,000

Company profit Increase by + (Increase in sales * Contribution margin ratio = 120,000 * 75% = $90,000

Thus, with the increase in 15% of sales of One-Mart , the profit of the   company increase by $90,000.

On November 1, Orpheum Company accepted a $12,400, 90-day, 8% note from a customer to settle his account. What entry should be made on the November 1 to record the acceptance of the note?

Answers

Answer:

Dr Note Receivable $12,400

Cr Accounts Receivable $12,400

Explanation:

Based on the information given we were told that on November 1 the company accepted a note from a customer in order to help settle the customer account of the amount of $12,400 which means that the Journal entry that should be made on the November 1 to record the acceptance of the note will be :

Dr Note Receivable $12,400

Cr Accounts Receivable $12,400

15-9: Harris Company must set its investment and dividend policies for the coming year. It has three independent projects from which to choose, each of which requires a $3 million investment. These projects have different levels of risk, and therefore different costs of capital. Their projected IRRs and costs of capital are as follows: Project A: Cost of capital: 17%; IRR: 20% Project B: Cost of capital: 13%; IRR: 14% Project C: Cost of capital: 7%; IRR: 9% Haris intends to maintain its 35% debt and 65% common equity capital structure, and its net income is expected to be $7,500,000. If Harris maintains its residual dividend policy (with all distributions in the form of dividends), what will its payout ratio be?

Answers

Answer:

Its payout ratio will be 22%

Explanation:

Residual dividend policy is a policy where a company uses the residual equity to fund dividend payments.

Accept Project A, B and C as they all have higher Cost of capital than the IRR

The total investment = $3,000,000 * 3 = $9,000,000

Dividend = Earnings - Investment in equity = $7,500,000 - 65%*$9,000,000 = $7,500,000 - $5,850,000 = $1,650,000

Dividend payout ratio = Dividend / Total earnings = $1,650,000 / $7,500,000 = 0.22 = 22%

Steve Colburn's portable sawmill used 100% for business, was completely destroyed by fire. The sawmill had an adjusted basis of $35,000 and a fair market value of $50,000 before the fire. The sawmill was uninsured. Steve's casualty loss is:________.1) $49,900.
2) $50,000.
3) $35,000.
4) $34,900.

Answers

Answer: $35,000

Explanation:

A casualty loss is simply a loss that an individual or business incurs when a property is damaged, or destroyed due to an unexpected or sudden event like fire, volcanic eruption, flood etc.

Here, Steve's casualty loss will be gotten when we compare both his adjusted basis and the fair market value and then we choose the lesser one. Since $35000 is lesser than $50000, therefore the answer will be $35000.

Mike Finley wishes to become a millionaire. His money market fund has a balance of $403,884 and has a guaranteed interest rate of 12%. How many years must Mike leave that balance in the fund in order to get his desired $1,000,000?
Assume that Sally Williams desires to accumulate $1 million in 15 years using her money market fund balance of $209,004. At what interest rate must Sallyâs investment compound annually? (Round answer to 0 decimal places, e.g. 5%.)

Answers

Answer:

Mike Finley

t = 7.999983133 years rounded off to 8 years

Sally Williams

r = 0.110000123 or 11.0000123% rounded off to 11.00%

Explanation:

Mike Finley

To calculate the time period it will take Mike Finley to become a millionaire, we will use the formula of future value of cash flow. The formula for future value of cash flow is as follows,

Future value = Present value * (1+r)^t

Where,

r is the interest rate or rate of returnt is the time period in years

Plugging in the values for Future value, present value and r in the formula, we can calculate the t to be,

1000000 = 403884 * (1+0.12)^t

1000000 / 403884  =  1.12^t

2.475958444 = 1.12^t

Taking log on both sides.

ln(2.475958444) / ln(1.12)  =  t

t = 7.999983133 years rounded off to 8 years

Sally Williams

We will use the same formula for future value of cash flows as we used above to calculate the rate at which investment should be compounded annually to grow to $1 million.

1000000 = 209004 * (1+r)^15

1000000 / 209004 = (1+r)^15

4.784597424 = (1+r)^15

Taking root of 1 on both sides.

(4.784597424)^1/15  =  (1+r)^15 * 1/15

1.110000123  =  1+r

1.110000123 - 1 = r

r = 0.110000123 or 11.0000123% rounded off to 11.00%

Other Questions
The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut a student performed an experiment, using a cocktail peanut, before it was burned the peanut half weighed .353 g. After burning the residue weighed .016 g. The energy released by the conjunction increased the temperature of 200. mL of water in the calorimeter by 7.2 degrees Celsius. Calculate the mass of peanut consumed in the combustion. twice the sum of k and 9 is 4 The product of a number and -5 is at least 35. Write as an inequality. who killed the district judge during the revolutionary movementanswer in one sentence Quick question for you all People who complain that video games involve too much sitting are probably old. They probably dont know very much about gaming, either. They dont realize that people can play virtual sports, such as tennis, on video games. There are video games for dancing, too. If people bothered to learn about the different kinds of video games, they would see how wrong they are. This students sample paragraph addresses the counterclaim. Critique this paragraph by answering the questions.What is the counterclaim?Video games are too violent.Video games make people inactive.Video games are different today.What evidence weakens the counterclaim?People who complain are old.Sitting too much is bad for people.There are video games for sports and dancing.What is the tone of the rebuttal?respectfulrudehumorous Mention the type of seeds that undergo hypogeal germination.What do we call the process of permanently stopping babies from breast feeding?plzz help it is due today 2) look closely at article XLVII. Rephrase it in your own words. How do you think this impacted the unity among slaves during the revolution?Please I need help! Use the interactive tool to graph the line given the following information: coordinates (1,3) slope of 2Based on your investigation, what is the value of b for the point (0,b)? what is carbogen and it's uses Please help!!!! ASAP!!! Thank you!!! Brainliest to right answer also based on answer 1 are the equations equivalent? help will give brainlyist and 5 star and heart (MC)Read the narrative and determine the point of view:"As you walked along the beach with your mom, you knew it was time to tell her the facts about what happened. She may never pardon you for your deceit, but you sense that she deserves to know. You think that to regain her trust, you need to demonstrate responsibility now for what you did and be honest about it." (5 points) aFirst person bSecond person cThird-person limited dThird-person objective eThird-person omniscient Why did the results of the presidential election of 1867 anger many democrats What percentage of the population of the colonies were patriots slausonn can you pls answer this quesion pls i have 3 min left