There are many properties of exponents. These properties are used to make problems with exponents simpler.

Choose one of the properties and explain why it is true. Then write a numerical expression and use the property you chose to simplify the expression.

Answers

Answer 1

Answer:

The product rule of exponents

Step-by-step explanation:

An expression is 6xa^3 x 3xa^4

This can be hard to answer but there are three rule. 1st you keep the base which is a. 2nd is add the exponents which are 4 and 3. 3rd is multiply the coefficient which is 6 and 3. and this answer would be 18xa^7.


Related Questions

Simplify.....
4p + 2p

Answers

Answer:

6p

Step-by-step explanation:

You just add 4 and 2 together and then put p at the end because they are like terms.

6p it’s basic math
4+2=6
And bring the p

The city council voted on a new tax. 18 council members voted in favor of the tax. The council has 90 members. What percentage of the council members voted in favor of the tax?

Answers

Answer:

20%

Step-by-step explanation:

18/90 = .2

Decimal to Percentage Rule: Multiply by 100

.2 * 100 = 20

20%

Hope this helps!  Have a nice day!

Answer: 20%
Explanation: You can set up a ratio. 18 / 90 to x / 100. x is the percentage of a full 100. Cross multiply, which gives you 1800 and 90. Divide, which gives you 20.

HELPP!! BRAINLIEST??

Answers

Answer:

answer number 4 I believe

Answer:

Its... x > 17

Step-by-step explanation:

1. Since the arrow is pointing to the left of the graph it means greater than.

2. The circle is also not filled in so it does not mean greater than or equal to.

3. The circle is open so that means it is JUST greater than.

Answer: x > 17

please help i don't understand. will mark brainliest

Answers

Answer:

Negative slope.

Step-by-step explanation:

It is a rule in slope.

Hope this helps!  Have a nice day!

Answer:

negative

Step-by-step explanation:

Left to Right, The line is pointing downwards, therefore is negative. When the line is pointing up it is positive. :)

Hope I helped,

PumpkinSpice1

Michael spent $266 on new door knobs for his entire house. Each door knob cost $14.
How many door knobs did Michael buy?
A. 16 door knobs
B. 18 door knobs
C. 19 door knobs
D. 22 door knobs

Answers

Answer:

19

Step-by-step explanation: 266 divided by 14 = 19

Find the Mean Absolute Deviation of the set: 48, 52, 54, 61, 30, 76, 77,50

A-94.5
B-11.5
C-448
D-56

Answers

you add all of it up and divide by how many numbers are.... so the answer would be D- 56
It would be -56 so in that case D

Henry divided his socks into five groups. Let s represent the total number of socks. Which expression and solution represent the number of socks in each group if s=20?

A. S/5; when s=20, the number of socks in each group is 4.

B. S/5; when s=20, the number of socks in each group is 15.

C. S-5; when s=20, the number of socks in each group is 4.

D. s-5; when s=20, the number of socks in each group is 15.

Answers

Answer:

A. 4 socks per group and S/5

Step-by-step explanation:

20 total # of socks ÷ 5 groups = 4 socks per group

So A. is correct.

David moved from a house that is 89 miles away from his workplace to a house that is 51 miles away from his workplace. What is the percent decrease in the distance from his home to his workplace? (round answer to the nearest whole number

Answers

38/89 is about 42.7 % (do the division, then to get percentage, shift decimal point 2 places to the right)

[PICTURE ATTACHED] HHHHEEEELLLPPP!

i already know the first one, but what the answer for the other two.

Answers

Answer:

Different

Step-by-step explanation:

The Same= Free points

i think the answer is different

After 10 weeks, how much money would William have in his bank account?

A.$165

B.$170

C.$200

D.$314

Answers

Answer:

if he earned $20 a weak after ten weeks it would be $200

Option A is correct,  $165 is the account balance of Willian after 10 weeks.

What is a function?

A relation is a function if it has only One y-value for each x-value.

Given that William bank account is modeled by the function f(x)=12x+45

f(x) equal to twelve times of x plus forty five.

Where x represents the number of weeks and f(x) represents the total balance.

45 represents the initial amount.

x represents the number of weeks.

We have to find the account balance after 10 weeks.

Plug in x as 10 to find the amount after 10 weeks.

f(x)=12(10)+45

When twelve is multiplied with ten we get 120,

=120+45

Add 120 and 45 we get

=165

Hence, $165 is the account balance of Willian after 10 weeks.

To learn more on Functions click:

https://brainly.com/question/21145944

#SPJ3

William bank account is modeled by the function f(x)=12x+45

Where x represents the number of weeks and f(x) represents the total balance.After 10 weeks, how much money would William have in his bank account

Today, everything at a store is on sale. The store offers a 20% discount.

a) The regular price of a T-shirt is $18. What is the discount price?

b) If the regular price of an item is dollars, what is the discount price in dollars? Write an expression.

c) The discount price of a hat is $18. What is the regular price?

Answers

Answer:

a. $14.4

b. $18 • .2 = $3.6

c. $21.6

Step-by-step explanation:

a. Make the 20% a decimal, and multiply by the regular price. Then, subtract that and you'll get the discounted price.

18 • .2 = 3.6

18-3.6 = $14.4

b. Use the equation multiplying the 20% as a fraction here.

c. Multiply $18 by .2 (the discount). Then, add that to the discount price ($18).

18 • .2 = 3.6

3.6 + 18 = $21.6

This is the last one for now I promise... - w -
the question is below.

Answers

Answer: y= x +3

1) find slope using rise over run. Find your coordinates. I used (-3,0) and (0,3). Rise over run with these values : 3-0/0- -3. You should get 1 as a slope after adding and simplifying. Y=1x+b is your equation. Plug in your y and x values to the equation: 3= 0x1 +b. Multiply: 3= 0+b. B is 3( your y intercept). The equation is y=x+3

Answer:y =4,-6 hope this helps you i do my best to helps you and if it did say thanks and if you have anymore questions feel free to ask and plz rate me brainest if it did have a good night

Step-by-step explanation:

help pls pic provided <3

Answers

There’s no picture there

Edward doesn't know how to do math. Can you help me help him lol

Answers

Answer: d = 147/4 or 36.75

Edward didn't isolate for 'd' by rearranging the terms.

(4/7)d = 21 (Multiply both sides by 7 to get rid of the 7 on the left side)

4d = 21 · 7

4d = 147 (Divide both sides by 4 to isolate for d)

d = 147/4 or 36.75

Already answered that lol sujdiff

Which point is not on the graph of the function y = x + 2?

(3, 5)
(6, 8)
(7, 9)
(2, 0)

Answers

Answer
Either
3,5 or 2,0
3,5 Is what I found
Hope this helped

Who else hate khan academy?

Answers

Answer:

samme

Step-by-step explanation:

Answer:

Me i tho im forced to watch it for school

Step-by-step explanation:

Pls answer all

Jenna feeds her cat twice a day. She gives her cat 3/4 can of cat food each time. She is having a friend care for her cat for 5 days and bought 8 cans of cat food, is that enough? If not how much does she need?

At the end of a party 3/4 cup of salsa dip is left, Anna divides the 4/5 of the dip equally between 2 friends. How much does each person get?
Your answer

A marathon is 26.2 miles long and water stations are placed every 2.62 miles along the route and at the starting line. How many water stations are there?

The number of runners who finished the marathon is 320. Runners donate $2.50 for each mile they run. How much money is donated?


Rational numbers

Answers

Answer:

Okay I will waste my precious time to answer

Step-by-step explanation:

1) It will be enough cat food for Jenna's nameless cat. The cat will only consume 7.5 of all cat food

2) Each friend received 3/10 of the dip

3) There are 10 water stations through out the marathon

4) I need to know amount of miles ran to answer, but if it is 26 miles your answer would be: $20800 was donated at the marathon

Answer:

i do not knot what to do

Step-by-step explanation:

1/2x+7=x+13 whats x. Giving Brainliest

Answers

Answer:

1/2x+7=x+13
x+14=2x+26
x-2x=26-14
-x=12
x=-12

Find the length of side b in the right triangle below. Round to the nearest tenth if necessary A. 8
B. 16
C. 32
D. 64​

Answers

Answer:

A

Step-by-step explanation:

Use the Pythagorean Theorem( a^2 + b^2 = c^2(hypotenuse)

6^2 + b^2 = 10^2

36+b^2 = 100

b^2 = 64

b = 8(Use square root rule)

A

Hope this helps!  Have a nice day!

Answer:

8

Step-by-step explanation:

Use pythagorean therom: a^2 + b^2 = c ^2

6^2 + b^2 = 10^2

36 + b^2 = 100

b^2 = 64

square root both sides to get rid of the ^2

sqaure root of 64 = 8

square root of b^2 = b

b = 8

-1 1/5 + -3/5 = ? please help asap

Answers

Answer: -4/5 or -0.8
Explanation: Because it is the answer

PLEASE HELP

David’s French test scores are 87%, 88%, 82%, 83%, 88%, 86%, and 88%. His latest test score is 100%. Which measure (mean, median, or mode) will be most affected by his latest score? Explain.

Answers

Answer:

Mean

Step-by-step explanation:

median will only shift by one number, mode is not affected, the mean has a large change.

seems the answer has been solved already

BRAINLIEST PLZ HELP!!!! Which inequality is represented by this graph?

Answers

Answer:

I think its the last one????

Step-by-step explanation:

Answer:

D.

Step-by-step explanation:

If the circle is filled in that means that it is equal to (the line under the inequality). And the inequality sign is facing the same direction as the graph (which in this case is right) so that means that the inequality sign in facing right!

Hope this helps!

Which graph represents the function f(x)=0.5^{x} +4

Answers

Answer

the second graph on the first image

Step-by-step explanation:

The graph of the function given is attached at the end.

What are algebraic expressions?In mathematics, an expression or mathematical expression is a finite combination of symbols that is well-formed according to rules that depend on the context.Mathematical symbols can designate numbers (constants), variables, operations, functions, brackets, punctuation, and grouping to help determine order of operations and other aspects of logical syntax.

Given is the exponential function as -

f(x) = (0.5)ˣ + 4

An exponential function is of the form → f(x) = eˣ.

The given function is -

f(x) = (1/2)ˣ + 4

The graph of the function is attached.

Therefore, the graph of the function given is attached at the end.

To solve more questions on expressions, visit the link below -

brainly.com/question/1041084

#SPJ6

Note: Enter your answer and show all the steps that you use to solve this problem in the space provided.

Show that the ratios
10/20
and
30/60
form a proportion by finding a common multiplier.
Show that the ratios in part (a) are equal by writing them in simplest form.

Answers

Answer:

Step-by-step explanation:

(A) We need to show both fraction of same proportion.

Ratio 1:  

If we multiply by 3 at numerator and denominator

(B) Now we simplify both ration into simplest form

Step-by-step explanation:

Here is the question

Answers

Answer:18 yards. PLEASE TOVE BRAINLIEST I AM NEW

Step-by-step explanation: You need to add all the sides to find the perimeter

Factor – 1/2 out of -1/2x+6

What is the factored expression of this

Answers

Answer:

-1/2(x-12)

Step-by-step explanation:

Since you need to factor -1/2 out of the given expression, you can say that

-1/2x+6 is equal to

-1/2(x-12)

Answer:  [tex]-\frac{1}{2}(x-12)[/tex]

==================================================

Explanation:

The terms of [tex]-\frac{1}{2}x+6[/tex] are [tex]-\frac{1}{2}x[/tex] and [tex]6[/tex]

Divide each term by -1/2 to factor out the -1/2

If we divide [tex]-\frac{1}{2}x[/tex] over -1/2, then we'll get x. Basically the -1/2 terms cancel.

If we divide 6 over -1/2, we get -12. It might help to think of it as 6/(-0.5) = -12.

So overall we have [tex]-\frac{1}{2}x+6 = -\frac{1}{2}(x-12)[/tex]

You can use the distribution property to check the answer.

1/2a - 1/2 = 1/4d - 3/4= 5/6s + 2/3=
Its supposed to be a coefficient! Plz help!

Answers

Yo I think you messed up me side there are two equal sign just pointing that out

Baldwin is helping his grandmother prepare for a big family dinner. First, he sets the oven temperature to 350°F to toast some bread. Later, he turns the temperature up 75°F to roast vegetables.
What is the oven temperature set at now?

Answers

Answer:

The temperature is not set at 425ºF

Step-by-step explanation:

I got this by adding 350º+75º= 425º

Hope this helps! Have a great day! :)

how do you find the y-intercept from a table and from a graph?

Answers

Answer:

When Finding the Y-Intercept from a Graph and Table, you are searching for the point of intersection between the equation and the y-axis. When finding the Y-Intercept from a Graph, you should find where the line from the equation crosses the y-axis. The point where the equation crosses the y-axis is the Y-Intercept.

Step-by-step explanation:

Find the following:
9 11/60 − 3 13/80

Answers

9 44/240 - 3 39/240= 6 5/240

Answer: 6 1/48

Answer:

Step-by-step explanation:

Let reformat the problem. :)

[tex]9\frac{11}{60} -3\frac{13}{80}[/tex]

Then we turn the equation in improper fractions.

[tex]\frac{551}{60} -\frac{253}{80}[/tex]

Then we need to have common denominators

Which is 240.

After solving, we get the answer [tex]\frac{1445}{24}[/tex]

Other Questions
What is your response? Why do u think sunny asks so many questions? anyone out there an expert on dreams?? Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date. Est ce que quelqu'un pourrait bien corriger mon expression ecrite ou donner son avie dessus s'il vous plait A $10,000 bond with 18%/year, compounded semi-annually (interest is paid every six month) is available in the market. The bond matures in 10 years. The closest PW of this bond if the purchaser can earn 12%/year, compounded quarterly is:_____. My annoying brother likes to drive me crazy. There is no other who is that lazy. He whines to my mom night and day, until eventually gets his way. What is a sister to do, when he screams til he's blue? There is no way to win, for he gets under your skin. He does his best to kill all joy. Oh, how my brother does annoy! What is the tone of the poem PLZ HELP!!!Will mark brainliest44. Show that the quadrilateral with vertices A(0,0), B(a,0), C(a + b, c) and D(b, c) is a parallelogram. hehe i need help with the whole quiz basically:IFind the decimal that is equivalent to: A. 1.714 B. 0.583 C. 0.0583 D. 6. Another engine reaches its top speed from rest in 7.5 s. It is able to perform 250,000 J of wok inthat time How much power does this engine have in that time?