What is the probability of getting one or fewer people with a chronic heart condition in a sample of 22 if 25% of the population in this age bracket?

Answers

Answer 1

The question is incomplete. The complete question is :

The National Center for Health Statistics reports that 25% of all Americans between the ages of 65 and 74 have a chronic heart condition. Suppose you live in a state where the environment is conducive to good health and low stress and you believe the conditions in your state promote healthy hearts. To investigate this theory, you conduct a random telephone survey of 25 persons 65 to 74 years of age in your state.

Suppose only one person in your survey has a chronic heart condition. What is the probability of getting one or fewer people with a chronic heart condition in a sample of 25 if 25% of the population in this age bracket has this health problem?

Solution :

Chronic heart disease is a condition where a person's heart have trouble to pump blood to the body. It develops over a period of time.

In the context, we can see from the figures from National Center for Health Statistics that the expected number of persons of age 65 - 74 years having a chronic heart disease is about

25 % of 25 = 6.25

Now by Poisson's ratio, the probability of choosing the sample where only one person having heart disease is 1.4%


Related Questions

Does this graph show a function? Explain how you know.

A. No, there are yvalues that have more than one x-value.

B. Yes, there are no yvalues that have more than one x-value

C. Yes, the graph passes the vertical line test. PREVIOUS

D. no the graph fails the vertical line test

Answers

Answer:

D. no the graph fails the vertical line test

chen is baking muffins and banana bread for brunch buffet. he needs 3 1/5 cups of flour to make the muffins and 3 2/3 cups of flour to make the banana bread. which is the best estimate of the number of cups of flour needed​

Answers

Answer:

I think 7 would be the estimate if im wrong this is the specific number 6 13/15

Step-by-step explanation:

Answer:

She will need aproximately 7 cups

Step-by-step explanation:

First, you add 3 1/5 and 3 2/3 which is 6.86666666667

Just round that answer up and that'll give you seven

This is for someone that i was suppost to give brainliest to lol

Answers

Answer:

ok does that mean me dont get brainliest

Step-by-step explanation:

You may use any notes from class or past assignments on this assessment. You may also use a
calculator. You may not look up any answers on the internet or use anyone else's work.
1.
The equation m=40g gives the distance in miles, m, that a car can travel using g gallons
of gas.
a. If the car has gone 140 miles, how much gas was used?
b. Write an equation that represents the inverse function: the gallons of gas as a
function of distance in miles.
Function C is defined by the equation cov) = 50 + 4y It mives the month con

Answers

Part a is 3.5 gallons

Find the m ULE in the triangle below.
L

109
RU

E49

Find the m ULE. Plzzzzz help hurry

Answers

m ULE is 60 degrees.
The sum of the angles inside a triangle is 180 degrees. Also don’t forget that the sum of supplementary angles is 180.

[solved] These Cylinders are similar. Find the volume of the smaller cylinder. Round to the nearest tenth. (the answer is 84.9 cm^3)

Answers

Answer:

84.9 cm³

Step-by-step explanation:

Height of the bigger Cylinder = 5 cm

Volume of the bigger Cylinder = 393 cm³

Height of the smaller cylinder = 3 cm

Volume of the smaller cylinder = x cm³

Since they are similar, therefore: the cube of their ratio would equal the ratio of their volume.

Thus:

[tex] (\frac{5}{3})^3 = \frac{393}{x} [/tex]

[tex] \frac{125}{27} = \frac{393}{x} [/tex]

Cross multiply

[tex] 125*x = 393*27 [/tex]

[tex] 125x = 10,611 [/tex]

Divide both sides by 125

[tex] \frac{125x}{125} = \frac{10,611}{125} [/tex]

[tex] x = 84.888 [/tex]

Volume of the smaller cylinder = 84.9 cm³ (to nearest tenth?

Find the length x of QR

Answers

Answer:

4.5

Step-by-step explanation:

If they are symilar their sides are in proportion so write the proportion

[tex]\frac{x}{5} =\frac{2.7}{3}[/tex]   you can pick any other 2 sides as long as you take them in the same order

x= 5*2.7/3=4.5

please someone help me out on this

Answers

Answer:

Step-by-step explanation:

28

Answer:

27⁰

Step-by-step explanation:

angles on a straight line add up to 180⁰

180-(39+86+28)=YVZ

Diego lives 1/2 miles from school.What is 50% of 1/2

Answers

Answer:

0.25

Step-by-step explanation:

x - -13 = 11 PLEASE HELP

Answers

Answer:

the answer is -2 because -(-13) translates to 13 and -2+13=11

(can I get brainliest)

Answer:

The answer is x = -2!

Derive the equation of the parabola with a focus at (−5, 5) and a directrix of y = −1.
f(x) = −one twelfth(x − 5)2 + 2
f(x) = one twelfth(x − 5)2 + 2
f(x) = −one twelfth(x + 5)2 + 2
f(x) = one twelfth(x + 5)2 + 2

Answers

Answer:

The equation of the parabola with a focus at (-5,5) and a directrix of y = -1 is [tex]y = \frac{1}{12}\cdot (x+5)^{2}+2[/tex].

Step-by-step explanation:

From statement we understand that parabola has its axis of symmetry in an axis parallel to y-axis. According to Analytical Geometry, the minimum distance between focus and directrix equals to twice the distance between vertex and any of endpoints.

If endpoints are (-5, 5) and (-5, -1), respectively, then such distance ([tex]r[/tex]), dimensionless, is calculated by means of the Pythagorean Theorem:

[tex]r = \frac{1}{2}\cdot \sqrt{[-5-(-5)]^{2}+[5-(-1)]^{2}}[/tex]

[tex]r = 3[/tex]

And the location of the vertex ([tex]V(x,y)[/tex]), dimensionless, which is below the focus, is:

[tex]V(x,y) = F(x,y)-R(x,y)[/tex] (1)

Where:

[tex]F(x,y)[/tex] - Focus, dimensionless.

[tex]R(x,y)[/tex] - Vector distance, dimensionless.

If we know that [tex]F(x,y) = (-5,5)[/tex] and [tex]R(x,y) = (0,3)[/tex], then the location of the vertex is:

[tex]V(x,y) = (-5,5)-(0,3)[/tex]

[tex]V(x,y) =(-5,2)[/tex]

In addition, we define a parabola by the following expression:

[tex]y-k = \frac{(x-h)^{2}}{4\cdot r}[/tex] (2)

Where:

[tex]h[/tex], [tex]k[/tex] - Coordinates of the vertex, dimensionless.

[tex]r[/tex] - Distance of the focus with respect to vertex, dimensionless.

If we know that [tex]h = -5[/tex], [tex]k = 2[/tex] and [tex]r = 3[/tex], then the equation of the parabola is:

[tex]y = \frac{1}{12}\cdot (x+5)^{2}+2[/tex]

The equation of the parabola with a focus at (-5,5) and a directrix of y = -1 is [tex]y = \frac{1}{12}\cdot (x+5)^{2}+2[/tex].

Mitchell walked 5/12 of a mile in 1/2 of an hour. At this rate, how far could Mitchell walk in 1 hour?

Answers

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

[tex]2 \times \frac{1}{2} hour = 1hour \\ [/tex]

Thus ;

[tex]2 \times \frac{5}{12} \: \: miles = \frac{10}{12} \: \: miles = \frac{5}{6} \: \: miles \\ [/tex]

,♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

I think the answer is 5/6

PLEASEEE HELP ITS FOR A GOOD CAUSE !!

Answers

Answer:

And what cuase might that be...? Jkjk ofc ill help

Step-by-step explanation:

Amswer is C. im 99 percent sure i did the math and to double check i put it into a site ans it said it was C! Hope this helps! :)

Last week Carlos spent 3 1/2 hours practicing piano. This was 1/3 the amount of time he spent reading. How long did Carlos spend reading last week?

Answers

Answer:

3 1/2 = 210 minutes

1/3 * 210 = 70 minutes = 1 hour and 10 minutes

Thank you and please rate me as brainliest as it will help me to level up

On solving the linear equation 3.5 = x/3 , we get that the time Carlos spent on reading last week was x= 10.5 hours

What is an linear equation in one variable?

Linear equation is an equation containing one unknown variable with power one and constants.

The standard form of an linear equation in one variable x is :

ax + b = 0 , where a, b are constants

x= -b/ a is solution if this equation or we can solve this equation by adding or subtracting , multiplying or dividing by same number to both sides.

Let Carlos spent x hours reading last week

Given that last week the time that Carlos spent practicing piano for 3 1/2 hours = 7/2 hours = 3.5 hours

Time spent on practicing piano = 1/3 ( time spent on reading)

3.5 = (1/3) x

Multiply both sides by 3

⇒ 3.5 ×3 =3×(1/3)x

⇒10.5 = x

Therefore, the time spent by Carlos on reading last week is 10.5 hours.

Also, learn more about linear equation from the link below:

https://brainly.com/question/24145091

#SPJ2

three less than the sum of a number and
twelve

Answers

Answer:

(x + 12) - 3

Step-by-step explanation:

I used x for "a number".

Hope this helps and pls do mark me brainliest:)

Twice the sum of a number and 6 is
more than 84.

Answers

Answer:

Step-by-step explanation:

yth ok

For homework, a student had to complete 54 problems total. If she finished 9 problems in
class, what is the ratio of problems she still needs to complete to problems that she's
already finished?

Answers

Answer:

10

Step-by-step explanation:

Answer:

45:9

Step-by-step explanation:

write -90 in simplest radical form
please help or i’ll failll

Answers


Search Results
Featured snippet from the web

Simplest radical form means simplifying the radical such that there are no square roots ,cube roots ,etc to find. When simplifying a fraction, if there is a radical, should it always be a numerator?

Find the equation of the line.
6
The line is parallel to y =--x + 1 and passes through the point (-7, -3).
7
The equation of the line is

Answers

Answer:

y = - x - 10

Step-by-step explanation:

y - (- 3) = - (x + 7)

y = - x - 10

A scientist is filling beakers of water for an experiment. He begins with 3 liters of water in a large container and each beaker holds 2/5 of a liter of water. How many beakers can the scientist fill?

Answers

Answer:

just looking for free point..

Step-by-step explanation:

Lae bought grapes for $1.50 per pound.

Answers

Answer:

Where is the question or is that it?

1.Use the numbers in the table to create

Ordered pairs

2.Pounds are graphed on the x - axis

3.Plot the ordered pairs on the graph

4.Draw a straight line that starts at the origin and connects all the points

Which of the following functions has the function rule y=x+4? (-2, 2), (-1,-5), (3.7)} {(-3, 1), (0.4), (2. 6)) (12.6). (-3.-7), (0.4) (0.2).(-2,-6). (1.5))​

Answers

Answer:

b. {(-3, 1), (0, 4), (2, 6)}

Step-by-step explanation:

PLEASE HELP!!!

DUE IN AN HOUR!!!

Answers

Answer:

Don't cheat u cheater...

Cuales son los gráficos que nos permiten analizar el movimiento rectilíneo

Answers

Step-by-step explanation:

Un modo de describir y estudiar los movimientos es mediante gráficas que representan distancia-tiempo (distancia en función del tiempo), velocidad-tiempo (velocidad en función del tiempo) y aceleración-tiempo (aceleración en función del tiempo).

There are stars to circle there are 4 stars and 2 circles how much is the ratio

Answers

Answer:

2:1

Step-by-step explanation:

The original ratio is 4:2. Divide both sides by 2. Then you get 2:1.

Answer:2 stars for every one circle

Step-by-step explanation:

hope you get what i mean if not sorry my friend

[(15 x 3) + 3] = (12-6) = N​

Answers

Answer:

45+3 = 6=N

48_6= N

42= N

:. N= 42

Step-by-step explanation:

:. N= 42

Answer:

did you mean to put 2 equal signs in this?

Step-by-step explanation:

that would make this false because the first part equals 48 and the second equals 6 and since 48 doesn't equal 6 this is a false statement

The length of the rectangle is 3ft less than twice the width,and the area of the rectangle is 27ft^2,find the diameter

Answers

Answer:

The dimensions of rectangle are:

width = w = 4.5 ftlength = l = 6 ft

Step-by-step explanation:

Let 'l' be the length and 'w' be the width of the rectangle

The length 'l' of the rectangle is 3ft less than twice the width 'w'.

so

[tex]l=2w-3[/tex]

Also, the area of the rectangle is 27ft^2.

[tex]A=27\:ft^2[/tex]

As the area of the rectangle has the formula:

[tex]\:A\:=\:l\times w[/tex]

so

[tex]27=\:l\times w[/tex]

so the equation becomes

[tex]27=\left(2w-3\right)\times \:w[/tex]

[tex]27=2w^2-3w[/tex]

[tex]2w^2-3w-27=0[/tex]

[tex]\left(w+3\right)\left(2w-9\right)=0[/tex]

if   [tex]ab=0\:\mathrm{then}\:a=0\:\mathrm{or}\:b=0\:\left(\mathrm{or\:both}\:a=0\:\mathrm{and}\:b=0\right)[/tex]

[tex]w+3=0\quad \mathrm{or}\quad \:2w-9=0[/tex]

[tex]w=-3,\:w=\frac{9}{2}[/tex]

as the width can not be negative, so

[tex]w=\frac{9}{2}=4.5[/tex] ft

As

[tex]l=2w-3[/tex]

[tex]l=2\left(4.5\right)-3[/tex]

[tex]l=9-3[/tex]

[tex]l=6[/tex]

So the dimensions of rectangle are:

width = w = 4.5 ftlength = l = 6 ft

Leila bought 3 bananas, which weighed a total of 3/4 of a pound . if each banana weighed the same amount , what is the weight of each banana ?​

Answers

Answer:

1/4

Step-by-step explanation:

3/4 (total weight)

3 bananas

(3/4)/3=1/4

PLS GIVE BRAINLIEST

80% of teenagers have access to some social media . If you do a random survey of 400 teenagers, what is the probability that between 300 and 340 of them will patronize it.

Answers

Answer:

P(300 < p^ < 340) = 0.9876 or 98.76%

Step-by-step explanation:

We are given;

Population proportion; p = 80% = 0.8

Sample proportion; p1^ = 300/400 = 0.75 and p2^ = 340/400 = 0.85

Sample size: n = 400

z-score formula for sample proportion is;

z = (p^ - p)/(√(p(1 - p)/n)

Thus;

z1 = (0.75 - 0.8)/(√(0.8(1 - 0.8)/400)

z1 = -0.05/0.02

z1 = -2.5

z2 = (0.85 - 0.8)/(√(0.8(1 - 0.8)/400)

z2 = 0.05/0.02

z2 = 2.5

From online calculator of probability between 2 z-scores, we have;

P(-2.5 < z > 2.5) ≈ 0.9876

What is the surface area in square inches of a cube with a side 7 inches long? HEL0 QUICK​

Answers

Answer: a = 294 square inches

Use the formula: A = 6a^2

Answer:

294

Step-by-step explanation:

A=6x²

A=6*7²

A=6*49

A=294

Other Questions
Why do phase changes occur?1. Compare: Set the Water temperature to 0 C and click Play. Observe the water molecules.Click Reset, set the Water temperature to 100 C, and click Play again.What do you notice? The water molecules are moving slightly faster at 100 C than at 0 C.[Note: This difference may be too small to observe easily.]2. Observe: Click Reset. The mean molecular speed of the water molecules is displayedbelow the container. Set the Water temperature to 0 C and Add/remove heat energy to400 J/s. Click Play.A. How does the mean speed of the water molecules change as they are heated?The average speed of water molecules increases as they are heated.B. Does the mean molecular speed change as much as the temperature as thewater heats up? Explain.Sample answer: For each degree of temperature change, the mean molecularspeed increases by about 1 m/s. At 100 C, the mean molecular speed is about17% faster than at 0 C.3. Explain: How is temperature related to the motions of molecules?The higher the temperature, the faster the molecules move.4. Observe: Click Reset. Set the Water temperature to 20 C and the Ice volume to 50 cc.Set Add/remove heat energy to 0 J/s. Click Play. How do the molecules in the liquidinteract with the molecules in the solid?The molecules of the liquid collide with the molecules of solid, gradually breaking the bondsbetween the molecules in the solid and causing the ice to melt. please help me asap Who was the established groups in Postville before the in-migration? What were their expectations of each of the new groups Jeremy find the cost by adding the percents. 25% off of $60 is equal to 15% off of $60, then subtracting 10% from that cost is equal to . The two total costs are HELP!!BRAINLIEST AND 10 POINTS !! Complete the analogyREBEL : ORTHODOXY :: (A) nonconformist : convention(B) radical : revolution (C) soldier : combat (D) scientist : theory Which statement illustrates bias in scientific research?A zoologist publishes incomplete data on sloths which supports their original hypothesis and notes that more research is required.A botanist publishes data about plant growth that does not support their original hypothesis and is replicable.An ecologist publishes data funded by a construction company which supports their original hypothesis that an endangered animal's territory is not endangered.A microbiologist publishes data funded by the National Institutes of Health that does not support their original hypothesis. Help me please!!! I need a short letter, using basic or simple teems, words, vocabulary. I would like to be Cabinet member perspective. But Natives is also fine with me. Thanks. Please need help Choose the words that complete the following sentence.Direct quotes needaround them, or else it is considered(1 point)O quotation marks/summarizingO quotation marks/plagiarismO parentheses/summarizingO parentheses/plagiarism I love you. You are worth it. What does this quote mean? Thanks! Ayala is making salad dressing. She mixes oil andvinegar in a blender until a smooth consistency isformed. Explain whether this is a heterogeneous or ahomogeneous mixture and why. Help?Jessica must determine how many packages of cookies and cupcakes to buy for her family reunion. Jessica's mother has asked her to buy the same number of each type of item but no more than 100 of each. At the bakery, Jessica finds that cookies are sold in packages of 12 and cupcakes are sold in packages of 9.Use the drop-down menus to select the answers that make each statement true.The greatest number of packages that Jessica can buy is _ packages of cookies and _ packages of cupcakes. explain what happens when particles collide When a story is told from the _____, the narrator has full knowledge of all the characters. omniscient third-person point of view reliable first-person point of view unreliable first-person point of view limited third-person point of view The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut a student performed an experiment, using a cocktail peanut, before it was burned the peanut half weighed .353 g. After burning the residue weighed .016 g. The energy released by the conjunction increased the temperature of 200. mL of water in the calorimeter by 7.2 degrees Celsius. Calculate the mass of peanut consumed in the combustion. twice the sum of k and 9 is 4