what is the range and domain of this question? im unsure​

What Is The Range And Domain Of This Question? Im Unsure

Answers

Answer 1

Answer:

Step-by-step explanation:

Domain is the independent variable (x)

Range is the dependent variable (y)

For each of these you would just put what x and y are equal to

For the Domain you would put:

0<=x<=3

<= is less than or equal to

For the Range you would put

1<=y<=4

The line is a function


Related Questions

How many solutions does the equation have?
x^4 + 7x^2 – 144 = 0


Answers

Answer:

The equation has no real solutions. It has 2 imaginary, or complex solutions.

Step-by-step explanation:

The pencils , p, we're divided into 6 groups of 2

⚠️⚠️Write an equation PLEASEE I’m almost done ⚠️⚠️

Answers

Answer:

6 divided by 2 =p (a made a little graph at the bottom to demonstrate)

Step-by-step explanation:

.  .  .  .  .  .          Graph←

.  .  .  .  .  .

-11/2 divided by 12/5.

Answers

Answer:

Exact Form:

−55/24

Decimal Form:

−2.2916...

Mixed Number Form:

−2 7/24

Step-by-step explanation:

Reduce the expression, if possible, by cancelling the common factors.

What is the probability of rolling at least one six on a pair of fair
dice?

Answers

It is a 67% percent chance.

HELP
The length of a rectangle is
[tex]18x ^{2} + 6x - 4[/tex]
and the width of the rectangle is
[tex]3x {}^{2} - 9x + 10[/tex]
what expression would represent the perimeter of the rectangle?​

Answers

Answer:

21x^2+3x+12

Step-by-step explanation:

HELP! Quickly! I need this ASAP

Answers

Answer:

y=10x+5

Step-by-step explanation:

y1-y2/x1-x2

5-15/0-1

-10/-1

10

The slope is 10

when the x is zero, y is 5 therefore 5 is the Y-intercept

y=10x+5

~PumpkinSpice1♥

help please!!!!!!!!!!!!!!!!!

Answers

Answer:

the answer is 9.5

Step-by-step explanation:

Answer:

I think it's C. 9.5

Hope this Helps!

Tony bought 255 1-inch nails and 5 boxes of 2-inch nails. Each box of 2-inch nails had equal amounts of nails in them. He bought a total of 620 nails. Find the number of nails in each box of 2-inch nails.

Answers

Answer:

73 nails

Step-by-step explanation:

Number of 1 inch = 255

Boxes of 2 - inch = 5

Each box of 2 _inch has equal amount of nails

Total number of nails = 620

Number of nails in each box of 2_inch nails:

Let Number of nails in each box = b

Number of 1_inch + 5 * number of 2_inch = 620

255 + 5b = 620

5b = 620 - 255

5b = 365

5b / 5 = 365 / 5

b = 73

Hence, there are 73 nails in each box of 2_inch nails

Express this ratio in its simplest form.

240cm : 3.6m

Answers

240 cm : 3.6m
convert 3.6m into cm :
3.6 x 100 = 360cm

240cm : 360cm
2 : 3

Mary is buying hair clips online. The online store charges a fee for each hairclip and a shipping fee. On Monday, Mary placed an order for 8 hairclips, and her total came to $33.75. On Friday, she placed an order for 11 hair clips, and her order came to $44.25. Find the price of each hair clip and the price of shipping.

Answers

$4 a clip $1.00 for shipping for each order because 33.75x44.25=78
4x19(clips total)= 76
78-76=2
2/2=1
so $1 for shipping for each order and $4 a clip

The offense of a high school football team gained 8 yards on first down and then lost 5 yards on second down. What expression represents the total amount of yards gained by the offense?

Answers

The answer would be 8 + (-5).

When Leroy went to bed, the temperature was – 2°F. He needed his electric blanket to keep warm! By morning, the temperature had risen 9°F. What was the temperature in the morning?

Answers

In the morning, it would’ve been 7 degrees.

Answer:

it would be 7

Step-by-step explanation:

the equation would be ( if you read the problem) -2+9 and that is equal to 7

Select all the pairs that could be reasonable approximations for the diameter and circumference of a circle. Explain your reasoning.

5 meters and 22 meters.

19 inches and 60 inches.

33 centimeters and 80 centimeters.

Answers

Answer:

19 inches and 60 inches

Step-by-step explanation:

Computer salespeople at a local store earn a $100 commission per computer for the first 5 computers they sell each month. For every additional computer they sell during that month, the commission per computer is 1.5 times the rate for the first five. Which of the following is the total commission earned by a salesperson who sells 8 computers in a month?

A. $190
B. $800
C. $950
D. $1,050
E. $1,200

Answers

Answer:

The answer is C.

Step-by-step explanation:

Firstly, you have to find the new commission sales after first 5 computera are sold. In order to do so, you have to multiply it by 1.5 :

$100 × 1.5 = $150

Next, you have to find the total amount :

($100×5) + ($150×3)

= $500 + $450

= $950

I need help quick please ​

Answers

i think the answer is none

the pyramid shown has a rectangular base and faces that are isosceles triangles find the total surface area to the nearest tenth

Answers

I think d is the correct answer

Answer:

I think is C.

Step-by-step explanation:

I'm so sorry if wrong!

HELPP
Lacey was looking at some data on World Cup soccer matches. She noticed a negative linear relationship
between the number of fans attending a match and the number of total goals scored in that match. Here is
computer output from a least-squares regression analysis for using attendance (in thousands of fans) to predict
the total number of goals scored:
Predictor
Coef
SE Coef
T
P
Constant
3.260
0.145
22.535
0.000
Attendance (thousands)
-0.009
0.003
-3.330
0.001
Use this model to predict the total number of goals scored in a match with 90 thousand fans in attendance.
You may round your answer to the nearest whole number of goals.
goals

Answers

Answer:

the answer is 2

Step-by-step explanation:

this was a question on my test on khan academy :D

How many liters each of a 45% acid solution and a 70% acid solution must be used to produce 50 liters of a 65% acid solution? (Round to two decimal places if necessary.)

Answers

Answer:

The number of liters of the 45% acid solution = 10 liters

The number of liters of the 70% acid solution is = 40 liters

Step-by-step explanation:

How many liters each of a 45% acid solution and a 70% acid solution must be used to produce 50 liters of a 65% acid solution? (Round to two decimal places if necessary.)

Let x be the number of liters of the 45% acid solution

The number of liters of the 70% acid solution is y

x + y = 50

x = 50 - y

Also

How many liters each of a 45% acid solution and a 70% acid solution must be used to produce 50 liters of a 65% acid solution?

We have:

45% × x + 70% × y = 65% × 50

0.45x + 0.70y = 0.65 × 50

0.45x + 0.70y = 32.5

We substitute x = 50 - y in the equation

0.45(50 - y) + 0.70y = 32.5

= 22.5 - 0.45y + 0.70y = 32.5

= - 0.45y + 0.70y = 32.5 - 22.5

= 0.25y = 10

Divide both sides by 0.25

= y = 10/0.25

y = 40 liters

x = 50 - y

x = 50 - 40

x = 10 liters

Hence,

The number of liters of the 45% acid solution = 10 liters

The number of liters of the 70% acid solution is = 40 liters

WILL MARK BRAINLEST, PLEASE HELP !!!

Answers

Answer:

rate of change = first derivative= g'(x)=-2x+6

plug -3 to 5 into that g'(x) equation, it will be your answer

Step-by-step explanation:

9514 1404 393

Answer:

  4

Step-by-step explanation:

The average rate of change of f(x) on the interval [a, b] is computed from ...

  m = (f(b) -f(a))/(b -a)

On the interval [-3, 5] the average rate of change is ...

  m = (f(5) -f(3))/(5 -(-3)) = ((-5^2 +6·5 +12) -(-(-3)^2 +6(-3) +12))/8

     = (-25 +30 +12 +9 +18 -12)/8 = 32/8

  m = 4

The average rate of change on the interval is 4.

__

Alternate solution

The first derivative of the function is ...

  f'(x) = -2x +6

The average rate of change of a parabolic function on an interval is the rated of change at the midpoint of the interval. Here, the midpoint is x=(5+(-3))/2 = 1, so the average rate of change is ...

  f'(1) = -2(1) +6 = 4

The function = 3describes the volume of a cube, , in cubic inches, whose length, width, and height each measure inches. Find the (instantaneous) rate of change of the volume with respect to when = 3 ℎ.

Answers

The correct structure of the question is as follows:

The function f(x) = x^3 describes a cube's volume, f(x) in cubic inches, whose length, width, and height each measures x inches. If x is changing, find the (instantaneous) rate of change of the volume with respect to x at the moment when x = 3 inches.

Answer:

Step-by-step explanation:

Given that:

f(x) = x^3

Then;

V = x^3

The rate whereby V is changing with respect to time is can be determined by taking the differentiation of V

dV/dx = 3x^2

Now, at the moment when x = 3;

dV/dx = 3(3)^2

dV/dx = 3(9)

dV/dx = 27 cubic inch per inch

Suppose it is at the moment when x = 9

Then;

dV/dx = 3(9)^2

dV/dx = 3(81)

dV/dx = 243 cubic inch per inch

The length of x 200 feet​

Answers

Answer:

If the length of x is less than 200, then add <.

If the length of x is more than 200, then add >.

If the length of x is 200, then add =.

Step-by-step explanation:

Estimate by rounding both numbers to tens and then divide.
61 ÷ 29 is approximately

Answers

Answer:

2

Step-by-step explanation:

Round: 61 → 60Round: 29 → 30Divide: 60 ÷ 30 = 2

I hope this helps!

La distancia que se recorre por carretera para llegar de Guadalajara a Puerto Vallarta, es de aproximadamente 306 km. Si se viaja a una velocidad promedio de 75km/h ¿cuánto tiempo se hará en ese trayecto?

Answers

Responder:

4.08 horas

Explicación paso a paso:

Velocidad = Distancia / Tiempo

Dado

Distancia = 306km

Velocidad = 75 km / h

Necesario

Hora

De la fórmula;

Tiempo = Distancia / velocidad

Sustituye el parámetro dado y obtén el tiempo;

Tiempo = 306 km / 75 km / h

Tiempo = 4.08 horas

Por lo tanto, utilizará 4.08 horas en ese viaje.

Find the slope and y-intercept for the table.



slope:

y-intercept:

Answers

Answer:

slope: 3

y-intercept: 3?

Step-by-step explanation:

Slope 3
Y-intercept is 2

The difference 3 1/2 minus 1 1/2 must be
between and

Answers

Answer:

2

Step-by-step explanation:

3 1/2 - 1 1/2 = 2

PLS GIVE BRAINLIEST

Mrs. Bell can grade 12 papers in 20 minutes. At this
rate, how many papers can she grade in one hour?

Answers

Answer:

36

Step-by-step explanation:

pls answer QUICK PLSSSS

Answers

Step-by-step explanation:

1) 13.57

+2.93

With this, we subtract from the back Meaning we add starting from back to forward;

13.57

+2.93

16.50

We have that because when you add 7 and 3 you get 10 so we write the 0 there and add the remaining 1 to the 5 making it 6 and then 6 plus 9 will give you 15 then we write the 5 then we add the remaining 1 to the 3 making it 4 then we add the 4 to the 2 making it 6 after this there is no remainder so we just write the 1.

What is the slope-intercept equation for the line below?
(5, 4)
(0, 2)

Answers

Answer:

=  

2/5x +2

Step-by-step explanation:

let me know if im wrong

hope it helps :)

Answer:

A. y=2/5x +2

step-by-step explanation:

hope this helped :-)

ABCD is a rhombus. Solve for x, if m AFB
(16x + 6)
B
F
D
C

Answers

2(8x+3) all you need to do is apply

What is the y intercept of y= -3x-2

Answers

(0,-2) or just -2 is the correct y intercept you can find this by graphing it:)

Answer:

-2

Step-by-step explanation:

we always know that the y intercept is after the x part. for example, if it was

y = 5x + 3 the y intercept would be 3. in this equation, it's negative 2 because of the subtraction sign

Other Questions
Help?Jessica must determine how many packages of cookies and cupcakes to buy for her family reunion. Jessica's mother has asked her to buy the same number of each type of item but no more than 100 of each. At the bakery, Jessica finds that cookies are sold in packages of 12 and cupcakes are sold in packages of 9.Use the drop-down menus to select the answers that make each statement true.The greatest number of packages that Jessica can buy is _ packages of cookies and _ packages of cupcakes. explain what happens when particles collide When a story is told from the _____, the narrator has full knowledge of all the characters. omniscient third-person point of view reliable first-person point of view unreliable first-person point of view limited third-person point of view The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut a student performed an experiment, using a cocktail peanut, before it was burned the peanut half weighed .353 g. After burning the residue weighed .016 g. The energy released by the conjunction increased the temperature of 200. mL of water in the calorimeter by 7.2 degrees Celsius. Calculate the mass of peanut consumed in the combustion. twice the sum of k and 9 is 4 The product of a number and -5 is at least 35. Write as an inequality. who killed the district judge during the revolutionary movementanswer in one sentence Quick question for you all People who complain that video games involve too much sitting are probably old. They probably dont know very much about gaming, either. They dont realize that people can play virtual sports, such as tennis, on video games. There are video games for dancing, too. If people bothered to learn about the different kinds of video games, they would see how wrong they are. This students sample paragraph addresses the counterclaim. Critique this paragraph by answering the questions.What is the counterclaim?Video games are too violent.Video games make people inactive.Video games are different today.What evidence weakens the counterclaim?People who complain are old.Sitting too much is bad for people.There are video games for sports and dancing.What is the tone of the rebuttal?respectfulrudehumorous Mention the type of seeds that undergo hypogeal germination.What do we call the process of permanently stopping babies from breast feeding?plzz help it is due today 2) look closely at article XLVII. Rephrase it in your own words. How do you think this impacted the unity among slaves during the revolution?Please I need help! Use the interactive tool to graph the line given the following information: coordinates (1,3) slope of 2Based on your investigation, what is the value of b for the point (0,b)? what is carbogen and it's uses Please help!!!! ASAP!!! Thank you!!! Brainliest to right answer also based on answer 1 are the equations equivalent? help will give brainlyist and 5 star and heart (MC)Read the narrative and determine the point of view:"As you walked along the beach with your mom, you knew it was time to tell her the facts about what happened. She may never pardon you for your deceit, but you sense that she deserves to know. You think that to regain her trust, you need to demonstrate responsibility now for what you did and be honest about it." (5 points) aFirst person bSecond person cThird-person limited dThird-person objective eThird-person omniscient