What is the wavelength of light falling on double slits separated by 2.00 μm if the third-order maximum is at an angle of 60.0∘?

Answers

Answer 1

Answer:

λ = 5.773 x 10⁻⁷ m = 577.3 nm

Explanation:

In order to solve this problem we will use the grating equation:

mλ = d Sin θ

where,

m = order = 3

λ = wavelength of light = ?

d = slit separation = 2 μm = 2 x 10⁻⁶ m

θ = angle = 60°

Therefore,

(3)λ = (2 x 10⁻⁶ m)Sin 60°

λ = 1.732 x 10⁻⁶ m/3

λ = 5.773 x 10⁻⁷ m = 577.3 nm


Related Questions

HELP ASAP!!!

Which graph shows the change in velocity of an object in free fall?

Answers

Answer:

the graph that show Change in velocity is no A

The graph that showing the velocity with respect to time for a free falling body is figure C where, the downward velocity will be higher due to the acceleration due to gravity.

What is velocity?

Velocity of a moving body is the measure of the distance covered per unit time. Thus, it is the ratio of distance to the time. Velocity is expressed in the units of Km/h, m/s. miles/h, ft./s etc.

The rate of change of velocity is called acceleration. The acceleration by the force of a gravitational field is called acceleration due to gravity g having the value 9.8 m/s².

The velocity - time graph shows a diagonal relation for a free falling body. A free falling body is initially at rest and falls downward with the negative velocity with the acceleration due to gravity. Therefore, figure B shows the change in velocity of a free falling body.

To find more on velocity, refer here:

https://brainly.com/question/18084516

#SPJ5

a book weighing 1.0 newton is lifted 2m. how much work was done?

Answers

Answer:

Work done, W = 2 J

Explanation:

Given that,

Weight of a book, W = F = 1 N

It is lifted to a height of 2 m

We need to find the work done. It can be calculated using the formula as follows :

W = F d

Put all the values,

W = 1 N × 2 m

W = 2 J

So, 2J of work was done.

A current of 3.75 A in a long, straight wire produces a magnetic field of 2.61 μT at a certain distance from the wire. Find this distance.

Answers

Given :

Current, I = 3.75 A .

Magnetic Field, [tex]B = 2.61\times 10^{-4}\ T[/tex]

To Find :

The distance from the wire.

Solution :

We know,

[tex]B = K\dfrac{2i}{d}\\\\d = 10^{-7}\times \dfrac{2\times 3.75}{2.61\times 10^{-4}}\\\\d = 0.00287\ m \\\\d = 2.87\times 10^{-3}\ m[/tex]

Hence, this is the required solution.

what is primary purpose of Pathfit?​

Answers

Answer:

to show the arts and creativity of the person and to show also the culture of the place..

Explanation:

A flat loop of wire consisting of a single turn of cross-sectional area 7.10 cm2 is perpendicular to a magnetic field that increases uniformly in magnitude from 0.500 T to 2.10 T in 1.07 s. What is the resulting induced current if the loop has a resistance of 1.60?

Answers

Answer:

The induced current is  [tex]I = 0.00066 \ A[/tex]

Explanation:

From the question we are told that

   The area is  [tex]A = 7.10 \ cm^2 = 7.10 *10^{-4} \ m^2[/tex]

   The initial  magnetic field is  [tex]B_i = 0.500 \ T[/tex]

    The magnetic field after t =1.07 s is  [tex]B_f = 2.10 \ T[/tex]

     The resistance of the loop is [tex]R = 1.60 \ \Omega[/tex]

Generally the electromagnetic field induced is mathematically represented as

   [tex]\epsilon = NA * \frac{B_f - B_i}{t}[/tex]

Where N is the number of turns which is 1 in the case of this question since there is only one loop

 So

       [tex]\epsilon = 1 * 7.10*10^{-4}* \frac{2.10 - 0.500}{1.07 }[/tex]

=>   [tex]\epsilon = 0.00106 \ V[/tex]

Generally the value of the current is mathematically represented as

        [tex]I = \frac{\epsilon}{R}[/tex]

       [tex]I = \frac{0.00106}{1.60}[/tex]

       [tex]I = 0.00066 \ A[/tex]

 



Which theory explains why gravity between two objects changes when the distance between them changes?

Einstein's theory because he suggested that the more distance there is between objects, the more space-time

curves and the greater the strength of gravity is.

Einstein's theory because he suggested that the more distance there is between objects, the more space-time

curves and the weaker the strength of gravity is.

Newton's theory because he suggested that the greater the distance between objects, the greater the pull of gravity.

Newton's theory because he suggested that the greater the distance between objects, the weaker the pull of gravity.

Answers

Answer:

Newton's theory because he suggested that the greater the distance between objects, the weaker the pull of gravity.

Answer: The answer is Newton’s theory because he suggested that the greater the distance between objects, the weaker the pull of gravity

Explanation: Just took the test i hope this help you enjoy :D

how does the uneaven heating of earths surface affects earths weather patterns

Answers

Answer: it causes some parts of the earth to get more radiation than others.

Explanation: earth rotates around the sun on a tilted axis so the Rays of the sun cause earth to have more radiation than it needs.

Help!!! Need answer ASAP.

Answers

Answer:

a = 0.5 [m/s²]

Explanation:

To solve this problem we must use Newton's second law which tells us that the sum of forces is equal to the product of mass by acceleration.

ΣF = m*a

F = force = 200 [N]

m = mass = 400 [kg]

a = acceleration [m/s²]

Now replacing:

200 = 400*a

a = 0.5 [m/s²]

How much would a spring scale with k = 120 N/m stretch, if it had a 3.75 J of work done
on it?

Answers

Answer:

0.25m

Explanation:

Given parameters:

Spring constant , K  = 120N/m

Work done  = 3.75J

Unknown:

magnitude of extension = ?

Solution:

To solve this problem;

           Work done  = [tex]\frac{1}{2}[/tex]kx²  

K is the spring constant

x is the extension

               3.75  =  [tex]\frac{1}{2}[/tex] x 120x²

               3.75  = 60x²

                x²  = 0.06

                x = √0.06  = 0.25m

A crate of books rests on a level floor. To move it along the floor at a constant velocity, why do you exert less force if you pull it at an angle Ï above the horizontal than if you push it at the same angle below the horizontal?

Answers

Answer:should be a matter of vector analysis.

Pulling above the horizontal has less surface area for the opposing friction

Explanation:

Which energy transformation occurs after a skydiver reaches terminal velocity? Gravitational potential energy transforms into thermal energy. Gravitational potential energy transforms into kinetic energy. Kinetic energy transforms into thermal energy. Kinetic energy transforms into gravitational potential energy. The answer is A. just took it

Answers

Answer:

a

Explanation:

The energy transformation occurs after a skydiver reaches terminal velocity is follows as;

A. Gravitational potential energy transforms into thermal energy.

B. Gravitational potential energy transforms into kinetic energy.

What is the gravitational potential energy?

The skydiver, when he is located at a certain height h above the ground, possesses gravitational potential energy, equal to:

U = mgh

where m is the mass of the skydiver, g is the gravitational acceleration and h is the height above the ground.

The skydiver gravitational potential energy decreases as the altitude decreases and his kinetic energy store increases as his speed increases.

When a skydiver jumps out of a plane, the energy transfers take place as;

The skydiver's kinetic energy store increases as their speed increases and the thermal store of the air and the skydiver increases, as there is friction between the skydiver and the air particles.

In the given situation, both options A and B are correct.

Learn more about gravitational potential energy;

https://brainly.com/question/11033151

#SPJ2

You discover a binary star system in which one member is a15MSun main-sequence star and the other star is a 10MSun giant. How do we believe that a star system such as this might have come to exist?

Answers

Answer:

Explanation:

The giant star must have at least once been the more massive star and then subsequently transferred some of its mass to its companion, the other star.

The two stars would be around the same age, so the more massive one would have turned into a giant first before the other one did or even had a chance to

A golf ball hit off a tee on level ground, lands 62 m away 3.0 later. What was the initial velocity of the golf ball?

Answers

62×3.0

think so not sure

What is the approximate horizontal velocity at which the boy in the diagram
threw the ball?


a. +5m/s

b. +20m/s

c. +25m/s

d. +30m/s

Answers

Answer:

D

Explanation:

5+25=30

why is it more painful to walk on gravel with your shoes off then on (3 marks please)

Answers

Answer:

Because shoes protect our feet from some of the most harmful platforms

Gravel has some small pebbles on it sometimes (or other sharp objects)

Gravel is pretty hard.

WHAT IS TRANS ATLANTIC SLAVE TRADE​

Answers

Hope this kinda helps!

A solid concrete block weighs 169 N and is resting on the ground. Its dimensions are
0.400m×0.200m×0.100m
A number of identical blocks are stacked on top of this one. What is the smallest number of whole blocks (including the one on the ground) that can be stacked so that their weight creates a pressure of at least two atmospheres on the ground beneath the first block?

Answers

Answer:

Explanation:

cross sectional area = .4 x .2 = .08 m²

Let n be the number of blocks required to make pressure = 2 atm

169 x n / .08 = 2 x 10⁵ N / m²

169 x n = .16 x 10⁵

n = 94.67

or 95 blocks .

Suppose a certain object has a mass of 5.00 kilograms on the earth. On the
Moon, where g is 1.6 m/s/s what would its mass be?*

Answers

Answer:

it would be 49.03325 Newton.

is 2/2 1 or 0? please help lol

Answers

Answer:

1.

Explanation:

Hello!

In this case, for such mathematical operations, we can wee that the slash represents a fraction or a division, say 8 ÷ 4 = 2, 6 ÷ 3 = 2, 20 ÷ 4 = 5, etc. In such a way, since the operation 2/2, represents 2 ÷ 2, it is clear that two is once in 2, therefore, the result is:

2 ÷ 2 = 1.

Best regards!

?
Which activity is health enhancing?
folding a load of laundry
driving long distances
O biking to school
unloading the dishwasher

Answers

The answer is Driving long distances

Answer:

biking to school

Explanation:

plato

Suppose two parallel-plate capacitors have the same charge Q, but the area of capacitor 1 is A and the area of capacitor 2 is 2 A.If the spacing between the plates, d, is the same in both capacitors, and the voltage across capacitor 1 is V, what is the voltage across capacitor 2?Express your answer in terms of V but do not type in the symbol "V"

Answers

Answer:

V' = V/2

Explanation:

The voltage across a parallel plate capacitor is given as follows:

V = Q/C

where,

V = Voltage across capacitor

Q = Charge on Capacitor

C = Capacitance of Capacitor = A∈₀/d

Therefore,

V = Qd/A∈₀

where,

A = Area of plate

d = distance between plates

∈₀ = permittivity of free space

FOR CAPACITOR 1:

Q = Q

d = d

A = A

V = V

Therefore,

V = Qd/A∈₀   --------------- equation (1)

FOR CAPACITOR 2:

V' = ?

Q' = Q

d' = d

A' = 2A

Therefore,

V' = Q'd'/A'∈₀

V' = Qd/2A∈₀

V' = (1/2)(Qd/A∈₀)

using equation (1):

V' = V/2

3.
A net force acting on an 8.0 kg box produces an acceleration of 3.5 m/s2. What acceleration will the same net force cause to a different box with a mass of 2.0 kg?

Answers

Answer:

13.5

Explanation:

The acceleration that the same net force would cause to a different box is 14 [tex]m/s^2[/tex].

Given the following data:

Mass of box A = 8 kg

Acceleration = 3.5 [tex]m/s^2[/tex]

Mass of box B = 2 kg

To find the acceleration that the same net force would cause to a different box:

First of all, we would determine the net force acting on box A by applying Newton's Second Law of Motion.

Mathematically, Newton's Second Law of Motion is given by the formula;

[tex]Net\;force = mass \times acceleration\\\\Net\;force = 8 \times 3.5[/tex]

Net force = 28 Newton.

Now, we can determine the acceleration for box B since the same net force act on it.

[tex]Acceleration = \frac{Net\;force}{mass} \\\\Acceleration = \frac{28}{2 }[/tex]

Acceleration = 14 [tex]m/s^2[/tex]

Read more here: https://brainly.com/question/24029674

How do we use energy transformation in our daily lives?

Answers

Answer:hat are some examples of energy transformation?

The Sun transforms nuclear energy into heat and light energy.

Our bodies convert chemical energy in our food into mechanical energy for us to move.

An electric fan transforms electrical energy into kinetic energy.

Explanation:

We pick up cups and place them in different places

A box of mass 7.0 kg is accelerated from rest across a floor at a rate of 2.0 m/s2 for 9.0 s .Find the net work done on the box. Express your answer to two significant figures and include the appropriate units.

Answers

Answer:

Explanation:

Step one:

given data

mass = 7kg

acceleration =2m/s^2

time= 9seconds

acceleration = velocity/time

velocity= acceleration *time

velocity=2*9

velocity= 18m/s

distance moved= velocity* time

distance= 18*9

distance=162m

we also know that the force on impulse is given as

Ft=mv

F=mv/t

F=7*18/9

F=126/9

F=14N

work done = Force* distance

work done=14*162

work=2268Joules

work= 2.27kJ

At an air show a jet flies at speed 1500 km/h on a day when the speed of sound is 342 m/s. What is the angle of the shock cone

Answers

Answer:

55 degrees

Explanation:

Given that an air show a jet flies at speed 1500 km/h on a day when the speed of sound is 342 m/s.

From the question above, we can get the below parameters

Object speed (V) = 1500 km/h

Sound speed ( v) = 342 m/s

Convert km/h to m/s

(1500 × 1000)/3600

Jet speed V = 416.67 m/s

Let's first calculate the mash number M.

M = V/v

M = 416.67 / 342

M = 1.2183

Formula for the angle of the shock cone is reciprocal of mash number. That is,

Sin Ø = 1 / M

Sin Ø = 1 / 1.2183

Sin Ø = 0.8208

Ø = sin^-1(0.8208)

Ø = 55 degree

Therefore, the angle of the shock cone is approximately 55 degrees

PLEASE HELP WITH A PHYSICS QUESTION!!!!


A bullet is dropped into a river from a very high bridge. At the same time, another bullet is fired from a gun straight down towards the water. If air resistance is negligible, how do the accelerations of the bullets compare just before they strike the water?


A. The acceleration is the same for both bullets.

B. The acceleration of the dropped bullet is greater.

C. The acceleration of the fired bullet is greater.

D. The comparison will depend on how high the bullets started.

Answers

Answer:

A. The acceleration is the same for both bullets.

Explanation:

The force of gravity is the attractive force applied by the earth on any object on its surface or neighborhood. And it is uniform under free fall at a definite location on the earth.

Since the the two bullets motion was at the same time and without air resistance, their acceleration would be the same before striking the surface of the water. This is because neglecting air resistance, all objects at the same height would fall with the same acceleration no matter their masses.

Section 4.1- Newton's First Law

Answers

Answer:

Newton's first law states that every object will remain at rest or in uniform motion in a straight line unless compelled to change its state by the action of an external force. This is normally taken as the definition of inertia. ... If that velocity is zero, then the object remains at rest.

Explanation:

Answer:

Newton's First Law is about inertia; objects at rest stay at rest unless acted upon and objects in motion continue that motion in a straight line unless acted upon. The amount of inertia an object has is simply related to the mass of the object.

A 0.300 kg ball, moving with a speed of 2.5 m/s, has a head-on collision with at 0.600 kg ball initially at rest. Assuming a perfectly elastic collision, what will be the velocity of the small ball if the heavier ball has a speed of 2m/s after collision.

Answers

Answer:

1.25 m/s

Explanation:

Given,

Mass of first ball=0.3 kg

Its speed before collision=2.5 m/s

Its speed after collision=2 m/s

Mass of second ball=0.6 kg

Momentum of 1st ball=mass of the ball*velocity

=0.3kg*2.5m/s

=0.75 kg m/s

Momentum of 2nd ball=mass of the ball*velocity

=0.6 kg*velocity of 2nd ball

Since the first ball undergoes head on collision with the second ball,

momentum of first ball=momentum of second ball

0.75 kg m/s=0.6 kg*velocity of 2nd ball

Velocity of 2nd ball=0.75 kg m/s ÷ 0.6 kg

=1.25 m/s

2

10 points

Find the total displacement of each of the motions.

a) You walk 45 m W, then 34 mW

b) You drive 5 km N, then 7 km S

c) You cycle 350 m E, then 800 m W, then 200 m E

d) You fly 850 km N then 850 km S

Answers

Answer:

a) s = 79 m W

b) s = 2 km S

c) s = 250 m W

d) s = 0 km  

Explanation:

We take the following sign convention for the directions:

North (N)  ---> positive

South (S)  ---> negative

East (E) ---> negative

West (W)  ---> positive

a)

45 m W, 34 m W

s = 45 m + 34 m

s = 79 m W

b)

5 km N, 7 km S

s = 5 km - 7 km

s = - 2 km

s = 2 km S

c)

350 m E , 800 m W, 200 m E

s = -350 m + 800 m - 200 m

s = 250 m

s = 250 m W

d)

850 km N, 850 km S

s = 850 km - 850 km

s = 0 km

What will happen to the charge and potential difference if the plate area were increased while the plate separation remains unchanged?

Answers

Answer:

Potential difference and charge will also increase.

Explanation:

Asking that :

What will happen to the charge and potential difference if the plate area were increased while the plate separation remains unchanged?

The charge is directly proportional to area of the plate. That is, increase in area of the plate of a capacitor will lead to the increase in the charges between the plates.

And since charge is also proportional to the magnitude of potential difference between the plates from the definition of capacitance of a capacitor which says that:

Q = CV

Therefore, increase in the area of the plate will also lead to increase in potential difference between the plates.

Therefore, if the plate area were increased while the plate separation remains unchanged, the charge and potential difference between them will also increase.

Other Questions
This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date. Est ce que quelqu'un pourrait bien corriger mon expression ecrite ou donner son avie dessus s'il vous plait A $10,000 bond with 18%/year, compounded semi-annually (interest is paid every six month) is available in the market. The bond matures in 10 years. The closest PW of this bond if the purchaser can earn 12%/year, compounded quarterly is:_____. My annoying brother likes to drive me crazy. There is no other who is that lazy. He whines to my mom night and day, until eventually gets his way. What is a sister to do, when he screams til he's blue? There is no way to win, for he gets under your skin. He does his best to kill all joy. Oh, how my brother does annoy! What is the tone of the poem PLZ HELP!!!Will mark brainliest44. Show that the quadrilateral with vertices A(0,0), B(a,0), C(a + b, c) and D(b, c) is a parallelogram. hehe i need help with the whole quiz basically:IFind the decimal that is equivalent to: A. 1.714 B. 0.583 C. 0.0583 D. 6. Another engine reaches its top speed from rest in 7.5 s. It is able to perform 250,000 J of wok inthat time How much power does this engine have in that time? The Yellow River is often called the cradle of Chinese civilization. It was along the banks of the Yellow River where the Chinese civilization first formed. The Yellow River is 3,395 miles long, making it the sixth longest river in the world. It is also called the Huang He River.Early Chinese farmers built small villages along the Yellow River. The rich yellow-colored soil was good for growing a grain called millet. The farmers of this area also raised sheep and cattle. Ancient China: Geography,Ken NelsonUsing context clues, which statement best defines the phrase "cradle of Chinese civilization?the place where the longest river in China startsthe place where most people in ancient China livedthe place where people in China began a farming culturethe only place in ancient China where people could farm What is an accurate statement about many of the first Africans to come to Louisiana?They came voluntarily.They were skilled laborers. They came in search of domestic work. They knew how to grow crops. Carter was given a box of assorted chocolates for his birthday. Each night, Carter treated himself to some chocolates. Carter ate 5 chocolates each night and there were originally 30 chocolates in the box. Write an equation for C,C, in terms of t,t, representing the number of chocolates remaining in the box tt days after Carter's birthday. When a space shuttle was launched, the astronauts on board experienced an acceleration of 29.0 m/s2. If one of the astronauts had a mass of 60.0 kg, what net force in Newtons did the astronaut experience? Which equation below has no solution?A) 3(6x + 8) = 24 + 18xB) 8(x + 4) = 12x - 6C) 5x - 4 = 2(4x + 8) - 3x can somebody do 4 and 5 for me