What was the name of the pamphlet that was written by Thomas Paine (a) common sense (b) leviathan (c) the social contract

Answers

Answer 1

Answer:

A) Common sense

Explanation:

Common Sense is a pamphlet written by Thomas Paine in 1775–1776 advocating independence from Great Britain to people in the Thirteen Colonies. - Wikipedia


Related Questions

Multipule chose
Why did people move west?


for improved economic opportunities

to improve their way of life

to set up industries

to find new land to grow wheat

for security in owning land

Answers

Gold rush and mining opportunities (silver in Nevada) The opportunity to work in the cattle industry; to be a “cowboy” Faster travel to the West by railroad; availability of supplies due to the railroad. The opportunity to own land cheaply under the Homestead Act

PLEASE HELP MEEEEE!!!!! THIS IS THE SECOND TIME I PUT THIS!!!!

While Washington was president, the political parties that formed in the United States were the (what?) Party, led by Hamilton and the (what?) Party, led by Jefferson.

These are the options for the two (what?) spaces:
Anti-Federalist.
Federalist.
Democratic-Republican.

Answers

Answer:

a and c

Explanation:

Answer:

While Washington was president, the political parties that formed in the United States were the Federalist Party, led by Hamilton and the Democratic-Republican Party, led by Jefferson.

Explanation:

Hilariously, the only reason I know this is because I've listened to the Hamilton musical a billion times lol.

Hope this helps!

Read the amendment. Which amendment in the Bill of Rights is this? The First Amendment The Second Amendment The Third Amendment The Fourth Amendment

Answers

Answer:

I'm pretty sure it's the first Amendment

Explanation:

Answer:

A. The First Amendment

Explanation:

This is a key aspect of a unitary system of government

-The national government can revoke only certain decisions made at lower levels of government.

- The national government controls all foreign and economic policy Certain powers are delegated to lower levels of government states , cities, etc. -and the national government has little or no authority in those areas.

- The national government has supreme power over lower levels of government , which carry out the policies of the national government .

Answers

Answer:

The national government has supreme power over lower levels of government, which carry out the policies of the national government .

Explanation:

A unitary form of government is a form of government that gives all major powers to the central government. There is no power sharing among the local and national government rather all the policies and decisions are made by the national government.

A key aspect of a unitary system of government is that national government has supreme power over lower levels of government, which carry out the policies of the national government.

The local governments can implement and execute only those decisions and policies laid out by the national government. Counties like France, UK, Colombia, etc have a unitary system of government.

How was Nestor 10 found?

Answers

Answer:Nestor-10 tries to attack Calvin because she found him and he's trying to stay lost. But the First Law still holds and he can't really bring himself to attack her. But still, Gerald Black panics and uses gamma radiation to kill Nestor-10.

Explanation:

Because Calvin was attempting to avoid being detected, Nestor-10 tries to assault him. However, the First Law is still in effect, therefore he finds it difficult to harm her. Gerald Black panics still and destroys Nestor-10 with gamma radiation.

Who was Nestor 10?

One of the modified Nestors that aids in the study of Hyper Base are Nestor-10. In other words, Nestor-10 has a modified First Law, wherein he is not allowed to harm others but may allow them to suffer harm. (In other words, he couldn't trip someone but may allow them to fall.) One of the modified Nestors that aids in the study of Hyper Base are Nestor-10.

In other words, Nestor-10 has a modified First Law, wherein he is not allowed to harm others but may allow them to suffer harm. the main character of "Little Lost Robot." Following instructions to "go lose (himself)" from Gerald Black, Nestor 10 vanishes. Nestor 10 obeys this order and hides in a chamber with 62 other robots who share his appearance.

Learn more about robots, here:

https://brainly.com/question/29379022

#SPJ2

Can someone help me write a more interesting and engaging hook sentence. The topic is about cultures. Mine is “ I have always believed that culture should be embraced, not hidden”
Just something more engaging :)

Answers

Answer:

Explanation:

It sounds pretty good to me. It directs our attention to what your point of view is. You've declared a side. Now you have to fill it in somehow. The next sentence should contain some idea of how a culture should be embraced.

One hint I can offer you. Don't overload the sentence you have. I have no idea where you are going, but you could say something like.

We should learn to appreciate the food people prepare. We should observe and celebrate the work that goes into good clothing and note what it is made of. (One more sentence of what to appreciate should do it).

Which of Newton's laws of motion explains why it is important for people to wear a seatbelt in a vehicle
1st law
2nd law
3rd law
4th law
(physical science)​

Answers

2nd law is the answer. It is due to inertia

Micah is doing a project for social studies on population around the world. Whic visual tools would be best to help Micah communicate the population of six different world regions? Check all that apply.

Answers

Answer:

These are the answer choices for the question:

Venn diagram.

line graph.

bar graph.

pie chart.

table.

And this is the correct answer:

bar graph.

pie chart.

table.

Explanation:

A bar graph can show the world population of the six regions very well, by showcasing, in a vertical manner, the proportion of the population of each region in relation to the other regions.

The same is true for a pie chart, but in this case, the proportion would be shown as a section of a circle, the largest sections corresponding to the most populated regions, and the smallest to the least populated regions.

Finally, a table would not show the relative proportions in a graphical manner, but can be used to deliver the information in a clear, accurate and numerical manner.

People can become a new creation through Jesus Christ.
True False

Answers

Answer:

100% True!!

Explanation:

Amen to this question!!!

True, Jesus does wonderful things and makes us a new person!! Amen !

Make sure you answer the following in complete sentences using examples to support your answers. Compare the Italian Peninsula and Greece, which would be the better place to defend if being attacked by invaders. Explain why one is better than the other geographically. What about its geography would make it strategically stronger to defend against attack? Why would the other place be more difficult to defend? (Mountains, climate, water, etc…)

Answers

Answer:

complete sentences using examples to support your answers. Compare the Italian Peninsula and Greece, which would be the better place to defend if being attacked by invaders. Explain why one is better than the other geographically. What about its geography would make it strategically stronger to defend against attack? Why would the other place be more difficult to defend? (Mountains, climate, water, etc…)

Which of the following would not have been the job of a poor working-class
woman?
A. Maid
B. Typist
C. Seamstress
D. Laundry worker

Answers

Answer:

B. Typist

Explanation:

Typist needed special education which took money to get which also poor people could not get. A maid does not take any education or money to be a poor person could be. A seamstress just took skill instead of money which a poor person could do. A laundry worker you just need to know how to do laundry so a poor person could do it. In conclusion, typist is the most ideal answer. Hope this helps! :))

Typist not have been the job of a poor working-class woman. Thus, option (b) is correct.

What is the working-class?

An economic term known as "working class" is used to refer to people who are employed in low-paying, physically demanding, or positions requiring little expertise.

Women from the working class carry out vital tasks. A typist was not a job of a poor that a woman from the working class would have had. Poor class working women do secretarial labor, cleaning, cooking, and serving our meals.

Therefore, option (b) is correct.

Learn more about on working-class, here:

https://brainly.com/question/17396903

#SPJ5

What evidence is there that America made progress, or failed to make progress, toward achieving equality from 1789-1850?

Answers

Answer:

The early nineteenth century saw a rise in the number of abolitionists who campaigned for the end of slavery and the repatriation of slaves to Africa. Their efforts, however, met with resistance from congress.

The establishment of the American Colonization Society by Robert Finley in 1816 was an example of this progress.

Explanation:

Even though not much was accomplished with the abolitionists' movement that saw an increase within this period, the efforts of the anti-slavery activists watered the ground that would soon lead to the emancipation of slaves. Between 1816 to 1840, a lot of slaves were repatriated to the colony of Liberia in Africa under the leadership of people like Robert Finley, Henry Clay, and James Monroe.

Frederick Douglass was also an African-American who actively campaigned for the freedom of slaves. Congress however resisted the movement and a demonstration of this was the passing of the Gag rule which allowed no discussions of slavery on the floor of congress. Several abolitionists like Elijah Lovejoy were also killed.

I will give 30 points and make you the brainiest
How did the first Mesoamerican civilizations differ from early Middle Eastern civilizations?
a. They did not rely on agriculture for survival.
b. They were not as complex in their social structure.
c. Their cities did not contain elaborate temples and palaces.
d. They were not located near a river, but in an area with abundant year-round rainfall.

Answers

Answer:

Option D

Explanation:

Answer:

D

Explanation:

just took the quiz

What are Buddhism's moral teachings?

Answers

Answer:

The teachings of the Buddha are aimed solely at liberating sentient beings from suffering. The Basic Teachings of Buddha which are core to Buddhism are: The Three Universal Truths; The Four Noble Truths; and • The Noble Eightfold Path.

Explanation:

What happens when a state law conflicts with a federal law?


The state law, under the Supremacy Clause, is declared invalid


The Federal law, under the Supremacy Clause, is declared invalid.


Article 6 of the Constitution encourages states to secede (leave the union).


Article 2 of the Constitution states that this situation will not occur.

Answers

Answer:

When state law and federal law conflict, federal law displaces, or preempts, state law, due to the Supremacy Clause of the Constitution. ... For example, the Voting Rights Act, an act of Congress, preempts state constitutions, and FDA regulations may preempt state court judgments in cases involving prescription drugs

Which statement best completes the list?



A.
People should try to connect with nature.

B.
Rulers must treat their people fairly.

C.
Politicians will always try to cheat people.

D.
People should be able to vote for their leaders.

Answers

Answer:

both A and B can be found in confuciosu literally, so choose one of them

Explanation:

What might happen if people were denied these rights?

Answers

Answer:

denied what rights?

Explanation:

How did the Nile and crop influence egyptian religion?

Answers

Religion and agriculture
Many of the Egyptians' religious observances were centered on their observations of the environment, the Nile and agriculture. They used religion as a way to explain natural phenomena, such as the cyclical flooding of the Nile and agricultural yields.

Why did the Mexican revolution last so many years?

Answers

It was a long and bloody struggle among several factions in constantly shifting alliances which resulted ultimately in the end of the 30-year dictatorship in Mexico and the establishment of a constitutional republic.

We must start now we must start here there's no other way for a life to go on if we don't believe in our selves we need food to live and survive if we don't take a risk how will we ever know what will happen so you must take a risk and settle here and begin to build our family we don't have enough s

Answers

Answer:

Okay, so take risks in your life is what you are trying to get at? .....ok?

Explanation:

what was the social and political impact of the transatlantic slave trade?

Answers

Answer:

the Transatlantic slave trade radically impaired Africa's potential to develop economically and maintain its social and political stability. The arrival of Europeans on the West African Coast and their establishment of slave ports in various parts of the continent triggered a continuous process of exploitation of Africa's human resources, labor, and commodities. This exploitative commerce influenced the African political and religious aristocracies, the warrior classes and the biracial elite, who made small gains from the slave trade, to participate in the oppression of their own people

Explanation:

what was the social and political impact of the transatlantic slave trade?

Why did Hoar believe that the Chinese Exclusion Act was “disrespectful to the ideals of the America Revolution?

Answers

Answer:

Hoar did not like the

America Revolution?

Explanation:

how did the Indian Reorganization Act improve the life of Native Americans

Answers

Answer:

it provided the return of surplus lands to the tribes rather than to homesteaders. It encouraged written constitutions and charters giving Indians the power to manage their internal occurrences

Answer:

In contrast to the horrific Indian Removal Act, the Indian Reorganization Act and the Indian Self-Determination and Education Assistance Act aimed to correct many of the mistakes made during the nineteenth century. The Indian Reorganization Act passed in 1934 and gave Native Americans the right to open businesses and created a system through which Native Americans could have access to vocational training and credit. The Indian Self-Determination and Education Assistance Act was even bigger, as it granted tribes the right to govern their own territory (limited tribal sovereignty) while still giving them access to federal money.

Explanation:

why was declaration of the rights of men and the citizens important- french revolution

Answers

it was important because it granted civil rights to some commoners.

In the mid-1300s, John Wycliffe was

a critic of the Protestant Church.
a reverend in the Protestant Church.
a critic of the Catholic Church.
a leader in the Catholic Church.

Answers

Answer:

answer C

Explanation:

A critic of the catholic church

In the mid-1300s, John Wycliffe was:

C. A critic of the Catholic Church.

According to the given question, we are asked to show the thing which John Wycliffe was most known for in America during the period of the mid-1300s.

As a result of this, we can see that John Wycliffe was known as a critic of the Catholic Church in the mid 1300s as he spoke against the various doctrines and dogmas which were practised by the Roman Catholic Church.

Therefore, the correct answer is option C

Read more about John Wycliffe here:

https://brainly.com/question/298030

What did Joseph McCarthy personally stand to gain from his anti-communist campaign?

Answers

Answer:

Joseph McCarthy’s accusations of communist infiltration into the U.S. Army Signal Corps and the army’s charge that McCarthy had sought preferential treatment for a recently drafted associate led to 36 days of televised Senate hearings, known as the McCarthy hearings, that began in April 1954. The event showcased McCarthy’s bullying tactics and culminated

Explanation:

Both pieces of writing attacked the practices of the
Catholic Church. Yet one led to a complete break, while the other did not. What in
Luther’s words seems uncompromising, and what in Erasmus’ words leaves more
room for reform?

Answers

Answer:

I do not understand this question please put more details

Explanation:

I would appreciate it.

What was the impact of the industrialization in Europe??

Answers

Answer:

Industrialization had many positive effects on society in Europe in the 18th and 19th centuries. The creation of power machines and factories provided many new job opportunities. The new machinery increased production speed of good and gave people the ability to transport raw materials

Explanation:

Which group in the Roman Republic's government was made up mostly of
patricians and voted to pass laws?
A. Tribunes
B. Dictators
C. Consuls
D. Senators

Answers

Answer:

Correct answer is D. Senators .

Explanation:

A is not correct answer as tribunes were elected by plebeians to represent their best interests in government.

B is not correct as dictators were not chosen by the people and would usually took power by their own hand.

C is not correct as because of certain changes introduced in the Roman laws it was possible that one of the consuls is plebeian.

D is correct as senators were chosen only from the side of patricians.

Answer:Senators

Explanation:

why did many Americans move to the Suburbs after World War II

Answers

The growth of suburbs resulted from several historical forces, including the social legacy of the Depression, mass demobilization after the War (and the consequent “baby boom”), greater government involvement in housing and development, the mass marketing of the automobile, and a dramatic change in demographics.
Other Questions
need answers asap1. risk factorsa. refers to being in good shapeb. the process and function of the bodyc. social needs, social behaviors, and social problems d. traits that increase the possibility of developing an illness or disease2. diabetesa. a disease in which the body produces and/or uses insulin in an inefficient manner, causing a high level of glucose (sugar) in the bloodb. a disease in which the body does not produce and/or use glucose in an effective manner, causing a high level of cholesterol (fat) in the bloodc. a disease in which the body produces too much insulin, and causes low levels of glucose (sugar) in the bloodd. a disease in which the body does not produce and/or use insulin in a effective manner, causing a low level of glucose (sugar) in the blood 3. flexibility a. the ability of a tendon to move through its full range of motionb. the ability of a joint to move through its full range of motionc. the ability of a muscle to move through its full range of motiond. the ability of a ligament to move through its full range of motion4. cardiovascular fitnessa. a term used to refer to the heart, lungs, and blood vessels. Cardio means heart and vascular means the blood vesselsb. the term used to describe the bodys ability to utilize oxygen at a maximal level of efficiencyc. the state of being free from disease or illnessd. traits that increase the possiblity of developing an illness or disease 5. physiologicala. the processes and functions of the bodyb. the processes of the mind c. social needs, social behaviors, and social problemsd. traits that increase the possiblity of developing an illness or disease 6. _____ is/are a/an aspect(s) that can set physical limits to our fitness potential a. heredityb. heart diseasec. environmentd. both a and c7. a condition in which the pancreas does not produce and/or utilize enough insulin to meet the bodys needsa. type 1 diabetes b. type 2 diabetesc. pancreatitis d. none of the above8. health-related factors refer to:a. cardiovascular efficiency b. muscular strength and endurance c. flexibility, and body composition d. all of the above9. skill-related factors refer to:a. agility and reaction timeb. cardiovascular efficiency c. aerobic endurance d. both a and c10. _____ is defined as the greatest amount of force that a muscle group can exert in a single efforta. muscular endurance b. muscular strength c. flexibility d. range of motion Geographers use two key questions every day. When using these two key questions to study the migration of birds, a geographer would ask "where are the birds going?" and "__________?" Which detail is relevant for an argument to make drivers who run through red lights pay a fee? Even though everyone knows that going through red lights is illegal, they do it anyway. The current fines, which are being used to maintain roads, are generating a lot of money for the city. People do not feel safe on the street because they know drivers are not stopping at red lights. The current fines are not high enough to discourage drivers from going through red lights. simply parmanent tissue real life application please help it's for my project Question 8 (1 point)Choose the correct form of the verb in the preterite. 1. Yo _________ (organizar) bien las cosas en la maleta. aorganiz borganizaste corganiz dorganic Please select the word from the list that best fits the definitionDoctors appointment today at 3:20pma.term calendarsb. weekly schedulec. daily organizer hellpppppp please I will give brainliest DUE 10:00 PM HELP ASAP. When Sarah left your house this morning her cell phone was 80% charged and then it started to lose 8% charge for each hour there after write an equation for B in terms of tea representing the charge remaining in series battery as percentage t hours after Sara left her house A news report says that 9% of middle school students are on the track team. There are 600 students in your middle school How many students in your school would you expect to be on the track team? HE Pad SATTE BAR HG West nus SAUNA w 1 PLEASE HELP! THIS A TIMED QUIZ!!Scientists found an artifact that has 25% of Carbon-14 left. Based on how much Carbon-14 is remaining, how old is the artifact that was found?A). 17,100 yearsB). 5,700 yearsC). 22,800 yearsD). 11,400 years Please help asap! Ill give brainliest!What theme does the excerpt convey?It is right to be wary of the unknown.Pride interferes with progress.Manners must be displayed in all situations.Strange animals cannot be trusted. What is your response? Why do u think sunny asks so many questions? anyone out there an expert on dreams?? Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA