Which of the following has a greater gravitational pull on the Earth?
1000 kilogram hippopotamus

100 kilogram human

1 kilogram cat

0.1 kilogram mouse

Answers

Answer 1

Answer:

a

Explanation:

Answer 2
A. 1000 kg hippo


Since it has a greater mass it will have a greater gravitational pull.

Related Questions

Metal atoms tend to give away valence electrons when they bond with non metals atoms what type of bond will form between the metal and nonmetal atoms and why does this bond form
(A) a covalent bond will form because electrons are transferred
(B) a iconic bond will form because electrons are transferred
(C) a covalent bond will form because electrons are shared
(D) a iconic bond will form because electrons are shared

Answers

Answer:

Answer is B

Explanation:

due to ionic bonds transferring electrons in order to be stable

Answer:

b 2

Explanation:

Which is an environmental factor that would MOST LIKELY have an adverse impact on the stability of an ecosystem?

Answers

It is desserts and oceans because the water helps

The climate change would most likely exhibit an adverse influence on the stability of an ecosystem.

Climate change impacts on ecosystems:

Climate change influences ecosystems in numerous ways. Warming may make the species to migrate to higher elevations or latitudes where temperatures are more favorable.

Climate change is resulting in the elevation of sea level, resulting in intrusion of seawater into the freshwater system, which is forcing the key species to relocate. Thus, removing the prey or predators, which are essential for the stability of the ecosystem.

Due to climate change, the vegetative biomes in the United States is predicted to change across 5 to 20 percent by 2100. A specific species due to climate change ca ripple through a food web and influence a broad array of other species, thus, disrupting the food web.

Change in climate and shift in ecological conditions could support the spread of parasites, pathogens, and diseases with potentially adverse influences on agriculture, human health, and fisheries. Climate change, along with pollution and habitat destruction is one of the stressors, which can result in the extinction of species.

Thus, climate change is the environmental factor, which would most likely exhibit an adverse influence on the stability of the ecosystem.

Find out more information about the impact of climate change on the ecosystems here:

https://brainly.com/question/11607190

if 28% of the bases in a DNA strand are guanine, what percentage are thymine

Answers

Answer:

22%

Explanation:

According to Erwin Chargaff in his complementary base pairing rule, a DNA molecule consists of four nucleotide bases that pair with one another in the follow order: Adenine (A) to Thymine (T), and Guanine (G) to Cytosine (C).

According to Chargaff, the amount of Adenine in the DNA equals the amount of Thymine while the amount of Guanine in the DNA equals the amount of Cytosine. The sum of all the bases equals 100%. That is;

A + T + G + C = 100%

In this question, if 28% of the bases in a DNA strand are Guanine, the amount of Cytosine will also be 28%. Hence,

28% + 28% + A + T = 100

56% + A + T = 100

A + T = 100% - 56%

A + T = 44%

Since, A = T

A/T = 44/2

A/T = 22%

Hence, the amount of Thymine in the DNA strand will be 22%

Can someone help me with this question please?

Answers

Answer:

B

Explanation:

They use echolocation (sound waves) because they cannot see the bottom of the ocean.

Good luck!

Graves’ Disease is an autoimmune disorder that causes an overproduction of the hormone produced in the thyroid. These hormones are responsible for cellular metabolism. What would this disorder probably result in?

Answers

Answer:

Explanation:

Graves' disease is an autoimmune disorder in which antibodies produced by your immune system stimulate your thyroid to produce too much T4. It's the most common cause of hyperthyroidism. Hyperfunctioning thyroid nodules (toxic adenoma, toxic multinodular goiter or Plummer's disease).

When experiencing oxygen debt, why do human cells not carry out the process of alcoholic fermentation?

Answers

I believe the answer is because oxygen is a fuel/input/reactant to alcoholic fermentation.

Which statement below does NOT correctly describe water's chemical
properties?

a. Water is a neutral substance - it is neither a base or acid

b. Water is an inert substance

c. Water is not flammable or combustible

d. Water is reactive and catalyzes many reactions that take place inside living things

Answers

Answer:

b.

Explanation:

This is incorrect, because, "water is a powerful accelerator of chemical reactions."

Credit to www.astronno.com

human rights violated when George Floyd was apprehended​

Answers

Answer:

tell me how to answer it

This is correct . True

i need help
i need ideas. Basically, you Create a story to teach class of 2024 and 2025 how to be good students. but its an Extra Credit Opportunity - Student Fable assignment.
i cant think of any ideas

Answers

Let me help you here :)

Start by presenting yourself, your name, where you from, etc. Then you can explain why is it important to complete all your assignments and study to get good grades... You can also talk about how High School will reflect in your future and applications for colleges. In your story write how important is to always pay attention in class and listen to your teacher.
Hope this helps!!

_______ is where both organisms gain from the interaction. A. Commensalism B. Mutualism C. Predation​

Answers

Answer:

B. Mutualism

Explanation:

Mutual means both parties feel the same way, so they both gain from the interaction. I just looked at the root of the word

Answer:

b . mutualism

Explanation: MUTUALISM IS A FORM  OF SYMBIOSIS  WHEREBY BOTH ORGANISMS INVOLVED BENEFIT FROM THE RELATIONSHIP

Sand dollars are radially symmetrical and have an internal skeleton but no backbone. Which phylum do sand dollars belong in?

chordates
echinoderms
arthropods
mollusks

Answers

Answer:

echinoderms

Explanation:

they are in the same family as starfish and sea urchins

Answer:

echinoderms

Explanation:

I hope this helps

differences between reproduction in mammals and amphibians.​

Answers

Answer:

the answer is a little weird but hope this helps

Explanation:

While all of these animals reproduce sexually (meaning that the species consists of males and females and mating involves the fetilization of eggs by sperm), reptiles and mammals reproduce through internal fertilization (inside the female) whereas amphibians practice external fertilization.

Answer:

While all of these animals reproduce sexually (meaning that the species consists of males and females and mating involves the fetilization of eggs by sperm), reptiles and mammals reproduce through internal fertilization (inside the female) whereas amphibians practice external fertilization

HELP ASAP EMERGENCY NEED NOW BRAINLIEST 100 POINTS!



A diagram showing two plates colliding, with one plate moving below the other. What type of plate boundary is illustrated in the image? What is the movement of one plate below another called?

Answers

Answer:

Hello There!! :D

Explanation:

Your answers are:

1. Convergent

2. Subduction

Hope this helps you!! ♥️♥️♥

- abakugosimp

Answer:

A. Convergent

B. Subduction

Explanation:

What type of plate boundary is illustrated in the image?

convergent

What is the movement of one plate below another called?

subduction

What is the lock and key theory of enzyme-substrate binding?

Answers

Answer:

Quick Reference. A theory to explain the mechanism of enzymatic reactions, in which it is proposed that the enzyme and substrate(s) bind temporarily to form an enzyme–substrate complex. The binding site on the enzyme is known as the 'active site' and is structurally complementary to the substrate(s).

A 10.0 cm3 sample of copper has a mass of 89.6 g. What is the density of copper?

Answers

Answer:

[tex]\boxed {\boxed {\sf d=8.96 \ g/cm^3}}[/tex]

Explanation:

Density can be found by dividing the mass by the volume.

[tex]d=\frac{m}{v}[/tex]

The mass of the copper is 89.6 grams.

The volume is 10 cubic centimeters.

[tex]m=89.6 \ g\\v= 10 \ cm^3[/tex]

Substitute the values into the formula.

[tex]d=\frac{89.6 \ g }{10 \ cm^3}[/tex]

Divide.

[tex]d=8.96 \ g/cm^3[/tex]

The density of copper is 8.96 grams per cubic centimeter.

EASY 7TH GRADE SCIENCE FIRST PERSON MARKED BRAINLIEST!!!!

Which information does a student need to differentiate between the speed and the velocity of a vehicle in motion

A. The rate of the motion
B. The direction of the motion
C. The change in the amount of motion
D. The amount of distance traveled during motion

Answers

Answer: The action from a force can cause an object to move or can speed up accelerate, to slow down (decelerate), to stop, or to change direction. Since any change in velocity is considered acceleration, it could be said that a force on an object results in the acceleration of a object.

Explanation:

Answer:

(B) The direction of the motion

Explanation:

Which of the following is NOT a stage of the Cell Cycle (somatic cells)?
1. Cytokinesis
2. Meiosis
3. Interphase
4. Mitosis

Answers

Answer:

Meiosis

Explanation:

Only reproductive cells/gametes use meiosis.

The part of the eye through which light travels
to the lens is the:
A iris.
B optic nerve.
C retina.
D pupil.

Answers

Answer: B optic nerve.

Explanation:

HELP ME POR FAVOR WILL GIVE BRAINLIEST AND YOU GET 25 POINTS, WHAT A STEALLLL.. ok

Which sequence best explains the relationship between DNA and protein structure and function?


DNA → gene → protein → trait

DNA → amino acid triplets → protein → trait

DNA base triplets → amino acid sequence → protein folding pattern → protein shape and function

DNA shape → amino acid sequence → protein shape and function

ty <33

Answers

Answer:

DNA base triplets → amino acid sequence → protein folding pattern → protein shape and function

Explanation:

From Google:

"The Rules of Protein Structure. The function of a protein is determined by its shape. The shape of a protein is determined by its primary structure (sequence of amino acids). The sequence of amino acids in a protein is determined by the sequence of nucleotides [base triplet] in the gene (DNA) encoding it."

please hellp asappppp In an area with very tall trees shading an understory of shorter trees, all of which have epiphytes growing on them, which of the following other conditions are most likely to exist as well?

It is near 30° latitude north or south or on the leeward side of a mountain range.
Moist air is rising over the area.
Night temperatures are much colder than daytime temperatures.
The soil has a thick layer of decomposed, nutrient-rich organic material.
There is an extremely high diversity of species in the area.
There is little rainfall and frequent fires regularly cut the vegetation to the ground.
4 and 6
1 and 3
2 and 5
3 and 4
please please give me the brainlyest answer

Answers

I think it’s this one(There is little rainfall, and frequent fires regularly cut the vegetation to the ground.)

Two amino acids unite by forming a(n) bond between them and releasing a molecule of . The union of many amino acids forms a macromolecule called a .

Answers

Answer:

Protein/nucleic acid/Carbohydrates/lipid

The correct and most appropriate words to fill in the blanks are: peptide, water and protein.

An amino acid can be defined as a simple organic chemical compound that is made up of an acidic carboxyl group (COOH), a basic amino group ([tex]NH_2[/tex]), and a variable (unique) side chain group.

Generally, an amino acid is typically named after two (2) of its functional groups and these are:

An acidic carboxyl group (COOH): it acts like an acid.A basic amino group ([tex]NH_2[/tex]): it acts like a base.

Basically, a peptide bond is formed between two amino acids when they unite. Also, this chemical reaction lead to the release of a molecule of water.

Finally, the union of many amino acids forms a macromolecule called a protein.

In conclusion, protein is a macromolecule which is formed as a result of the union of many amino acids.

Read more: https://brainly.com/question/14681125

A line passes through the points( -3,-4) and (6,2)

Answers

What are you asking? Slope? If so. You would do change in y over change in x. So subtract 2 and -4 to get positive 6, then subtract 6 and -3 to get positive 9. Your slope is either 1/3 if it’s increasing, or negative 1/3 if it’s decreasing.

Answer:

y = ⅔x - 2

Explanation:

We can solve for a linear equation of a line that passes through these two points by the elimination method and then substitute.

We simply write these two points in the form y = mx + c, where m is the gradient and c is the y-intercept (offset). So:

-4 = -3m + c

2 = 6m + c

____________ -

We can first eliminate c to solve for m and then substitute m back into either equation to solve for c. (See attached image for solving steps)

Then, we get:

m = ⅔

c = -2

so y = ⅔x - 2

Open Response 2 part A: Plant cells and fungal cells have many of the
same types of organelles. Structures X and Y are found in both plant cells
and fungal cells. Structure Z is found in plant cells, but not in fungal cells. A
- What is party?
X
Z

Answers

The answer will be z because u can dance and take the L on black kids

HELP!!! MAJOR GRADE!!!!!

Gregor Mendel conducted thousands of genetic experiments using pea plants. Mendel is called the Father of Genetics because it was these studies that lead to the principles of genetics. In one of his many experiments, he crossed purple-flowered pea plants with white-flowered pea plants. Much to his surprise, all of the offspring turned out to be peas with purple flowers in appearance.

Although Mendel used the term factors instead of genes, how did Mendel explain why all the pea plants had purple flowers and not a mixture of white and purple flowers?

A.The offspring received the factors (genes) from both parents, but the genotype for purple flowers dominated over white flower pea plants.

B.The offspring only received the factors (genes) from the parent with the genotype for purple flowers and nothing from the white flower parent.

C.The offspring received the factors (genes) from both parents, but the phenotype for purple flowers dominated over the factor for white flowers.

D. The offspring only received the factors (genes) from the parent with the phenotype for purple flowers and nothing from the white flower parent.

Answers

Answer:

A

Explanation:

The purple gene was dominant, so though the plants got "factors" from both parents, only the purple gene was expressed in their phenotype (purple petals).

Explain how one celled organisms get oxygen in water.

Answers

Answer:

n unicellular organisms, oxygen diffuses across the cell membrane into the cell. Carbon dioxide diffuses out of the cell once the concentration of carbon dioxide is higher inside the cell than it is outside of the cell. Some micro-organisms, including some bacteria and fungi, can survive without oxygen.

Explanation:

Which of the following is the most important reason to maintain a high level of cardiovascular health?
A. A higher level of fitness makes it easier to develop larger muscles.
B. A higher level of fitness makes you more attractive to other people.
C. A higher level of fitness allows you to live a longer, healthier life.
D. A higher level of fitness improves your IQ.

Answers

Answer:

C

Explanation:

I think because the more healthier you are, the longer you'll live

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Answers

Answer:

u want step by step?

Explanation:

Blood has a lower concentration of hydrogen ions than cellular cytoplasm. What does that tell us about the pH?

Answers

Answer:Acids and bases In the human body, both blood and the cytosol (watery goo) inside of cells have pH values close to neutral. ... A base, in contrast, raises pH by providing hydroxide (OH −start superscript, minus, end superscript) or another ion or molecule that scoops up hydrogen ions and removes them from solution.

Explanation:

What property is being shown in the picture below?
a. capillary action
b. adhesion
c. cohesion
d. all of the above

And explain why.

Answers

Answer:

C. Cohesion

Explanation:

The paper clip is using the “surface tension” to float!

Spongy tissue is best described as dense smooth and homogenous
True or false

Answers

false, it’s compact
Other Questions
11 924 in long division 20 plus 4000??????? Directions - Convert each equation to slope intercept form.A) 2x + 2y = 10B) 12 + 4y = -44 Think About the Process The length of a rectangle is twice the width. The area of the rectangleis 86 square units. Notice that you can divide the rectangle into two squares with equal area. Howcan you estimate the side length of each square? Estimate the length and width of the rectangle.How can you estimate the side length of each square?OA. Estimate V86.OB. Estimate V43 .V 86OC. Estimate4.43OD. Estimate4The rectangle is units long and units wide..(Round to the nearest tenth as needed.) give me one example of how you interact with the biosphere? Empresarios generally preferred to settle farmers rather than ranchers? Need help with this question doing test please meeee The imagery used in the lines allows the reader toRead the lines from "84" by Rabindranath Tagore.The bees forget to sip their honey; drunken with lightthey foolishly hover and hum....Laughter floats in the air like foam on the flood.O visualize the color of the honeycombs.o imagine the sounds of the bees and laughter.O visualize the people who are laughing.imagine what the river looks like when it floods. Drag and drop the constant of proportionality into the box to match the table. If the table is not proportional, drag and drop "not proportional" into the box.x 0 2 4 6y 0 3 6 9 What innovation allowed for skyscrapersto be built during the AmericanIndustrial Revolution?A. stronger wood products based on carpentry techniquesB. stronger steel because of the Bessemer processC, the invention of cement and concreteD. the invention of the steam engine HURRY HELP NOW!! Solve for x please !!!! HURRY FAST. It is known that complex carbohydrates provide more sustained energy over time than simple sugars such as sucrose. Complex carbohydrates are polysaccharides, which are long chains of smaller sugar molecules bonded together. Simple sugars are monosaccharides that contain only one molecule. Why do complex carbohydrates provide more energy over time versus simple carbohydrates? Complex carbohydrates have more chemical bonds to break than simple sugars, which takes longer for the body to digest and provides more units of energy for the body to use. Complex carbohydrates have bonds that contain more thermal energy than those in simple carbohydrates, which is released when they go through the digestive process. Complex carbohydrates provide Calories for the body while simple carbohydrates provide calories. Calories are bigger than calories and provide more energy. Complex carbohydrates take less energy to digest, which means that the body does not spend all of its calories digesting the food. This saves calories for the body to use later. There are many ways one can approach conflict. Decisions regarding conflict are based on the importance of issues and/or relationships. The way in which one handles conflict will directly affect the effectiveness of the conflicts outcome.How comfortable are you with the conflict? Conflict Styles: How people respond to conflict.* Avoiding--Issue and relationship both are insignificant. Accommodating--Relationship is more important than the issue. Forcing--The issue is more important than the relationship. Compromising--Cooperation is important (give a little, get a little). Collaborating--Relationship and issue are both important (takes more time)When analyzing your conflict style in a particular situation, ask the following questions: How is this conflict style working for you? What are your needs, and are they being met? What outcome could using this conflict style lead to? Are you satisfied with the outcome of this conflict style? Are there situations in which you change your conflict style? Are conflict styles situational? What would it take for you to change your conflict style? How would using a new style affect the outcome?Clinched Fist Activity (find someone at home - parents, siblings or a friend)With a partner, one of you clench your fist. The other try to figure out a way to unclench their fist. You have 30 seconds...Processing What happened? How did you get the person to unclench his or her fist? What worked? What didnt work? What did you do to overcome the challenges?Conflict Outcomes Win-Win Win-Lose Lose-Win Lose-Lose Which expression results in a sum or difference ofthe answer choices are Select all the rates that are unit rates. 1 1/3 2 3/1 2/3 3/11/9 1.Which of these expressions is equivalent to 3(x - 2)?A.3x 6B.3x2C.3x + 2D.3x + 6 What is the absolute value of 2-9i Which of the following descriptions best describe a liquidAtakes the shape and volume of its containerBmatter is made of atoms so tightly packed together that they cannot move aroundChas a definite volume, but takes the shape of its container What is the advantage of using mass media?A. The information is less biased than that communicated in otherforms of mediaB. The information is more truthful than that communicated in otherforms of media.C. The information is available to a larger audience than isinformation communicated in other forms of media,D. All of the above Cual es la similitud entre el cantar del mio cid y la celestina? please help me with this question:)