fill in the complementary bases according to the base-pair rule.
a | t | c | c | g | a | t | a | g | c | t | t | a | g
Christopher Columbus used the presence of suspended seaweed in the ocean to
determine how far away he was from the coast of the Africa. Seaweed, or kelp, is
placed under the Protista kingătom. What type of protist did Columbus see?
a)protozoa
b) slime mold
c) water mold
d) brown algae
Brown algae is the type of protist Columbus saw. Therefore, option (D) is correct.
What are brown algae?Seaweed is a type of brown algae, which is a type of protist that belongs to the kingdom Protista. Brown algae are large, multicellular algae that grow in the ocean and are often found in shallow, warm waters. They have a complex structure and are made up of many cells that are organized into tissues and organs. Brown algae are photosynthetic, meaning they use sunlight to produce energy and nutrients, and they are an important source of food and habitat for many marine organisms.
Other types of protists include protozoa, which are single-celled, heterotrophic organisms that can move using cilia, flagella, or pseudopodia; slime molds, which are fungi-like organisms that can move and are often found in moist environments; and water molds, which are fungi-like organisms that can grow in water and can cause disease in plants and animals.
Learn more about brown algae, here:
https://brainly.com/question/8717436
#SPJ2
Which of the following is the most important reason to maintain a high level of cardiovascular health?
A. A higher level of fitness makes it easier to develop larger muscles.
B. A higher level of fitness makes you more attractive to other people.
C. A higher level of fitness allows you to live a longer, healthier life.
D. A higher level of fitness improves your IQ.
Answer:
C
Explanation:
I think because the more healthier you are, the longer you'll live
A yellow-skinned CHNOPS meets the blue-skinned CHNOPS of their dreams. They get married and have a green-skinned CHNOPS baby. What type of inheritance (Complete dominance, Incomplete dominance, or Co-dominance) is illustrated by this example? Pick the best answer with the correct justification
A.Complete dominance, because it blends
B.Incomplete dominance, because you see two traits
C.Co-Dominance - because it blends D.Co-Dominance, because you see two traits
E.Incomplete dominance, because it blends
F.Complete dominance, because you see two traits
Answer:
uwiwiwuwwieh
Explanation:
Answer
co-dominance
recessive
Explanation:
100 on edge trust me!!
Why is ATP production Constant?
Proteins and carbohydrates have many functions in the body of an organism. Specific proteins and carbohydrates perform specific tasks. Information about
a protein and a carbohydrate is given below.
Ferritin
Ferritin is a protein containing Iron, which is
needed by all living things. Iron is found
In hemoglobin and in cytochromes, which
function in metabolism. Free iron can
damage proteins, lipids, and nucleic acids.
Glycogen
Glycogen is a carbohydrate that consists of
glucose molecules. It can be hydrolyzed as
glucose as needed by an organism.
How are ferritin and glycogen similar in their primary functions for an organism?
O Both store materials needed by the organism.
Both store energy used by the organism.
Both support the structure of the organism.
O Both store information for the organism.
Answer:
Both store materials needed by the organism.
Explanation:
Proteins and carbohydrates are two biomolecules present in living organisms. They perform varying functions in the body of an organism. According to this question, a specific protein (ferritin) and carbohydrate (glycogen) is described.
Ferritin is a protein molecule containing Iron (Fe). Iron is needed by living organisms as it plays a vital role in organism's metabolism. On the other hand, glycogen is a carbohydrate molecule that is made up of glucose molecules, needed by living organisms.
Based on the description of the two biomolecules provided, they are similar in their primary functions for an organism in the sense that THEY BOTH STORE MATERIALS (glucose and iron) NEEDED BY AN ORGANISM.
HELP ASAP EMERGENCY NEED NOW BRAINLIEST 100 POINTS!
A diagram showing two plates colliding, with one plate moving below the other. What type of plate boundary is illustrated in the image? What is the movement of one plate below another called?
Answer:
Convergent
Subduction
Explanation:
Answer:
B. convergent
C. subduction
Explanation:
Why does it take longer for your body to break down complex carbohydrates than simple carbohydrates?
Explanation:
complex carb pack more nutrients are simple carbs that are high in fiber and digest more slowly this makes them more ceiling which means a good option to for weight control
The small intestine is where carbohydrates are chemically broken down, instead of the stomach. The disaccharides and pancreatic amylase complete the chemical cleavage of digestible carbs.
What are the complex carbohydrates in the body?The building blocks of large polysaccharides are lengthy, complicated chains of sugar molecules.
Peas, beans, whole grains, and vegetables are examples of foods that are sources of complex carbohydrates. The body converts simple and complex carbohydrates into glucose (blood sugar), which is then used as fuel.
Longer-lasting blood glucose increase and longer-lasting energy elevation are produced by complex carbs.
Therefore, complex carbs are more efficient in giving the body energy, which is the main purpose of carbohydrates.
Learn more about complex carbohydrate here:
https://brainly.com/question/9384195
#SPJ2
How do structures in organisms compare with structures of non-living things such has construction cranes, buildings, ships, airplanes, or bridges?
if 28% of the bases in a DNA strand are guanine, what percentage are thymine
Answer:
22%
Explanation:
According to Erwin Chargaff in his complementary base pairing rule, a DNA molecule consists of four nucleotide bases that pair with one another in the follow order: Adenine (A) to Thymine (T), and Guanine (G) to Cytosine (C).
According to Chargaff, the amount of Adenine in the DNA equals the amount of Thymine while the amount of Guanine in the DNA equals the amount of Cytosine. The sum of all the bases equals 100%. That is;
A + T + G + C = 100%
In this question, if 28% of the bases in a DNA strand are Guanine, the amount of Cytosine will also be 28%. Hence,
28% + 28% + A + T = 100
56% + A + T = 100
A + T = 100% - 56%
A + T = 44%
Since, A = T
A/T = 44/2
A/T = 22%
Hence, the amount of Thymine in the DNA strand will be 22%
What process forms water vapor to turn into clouds?
Answer:
condensation
Explanation:
The water cycle
evaporation--> condensation--> precipitation-->repeat
When experiencing oxygen debt, why do human cells not carry out the process of alcoholic fermentation?
A 10.0 cm3 sample of copper has a mass of 89.6 g. What is the density of copper?
Answer:
[tex]\boxed {\boxed {\sf d=8.96 \ g/cm^3}}[/tex]
Explanation:
Density can be found by dividing the mass by the volume.
[tex]d=\frac{m}{v}[/tex]
The mass of the copper is 89.6 grams.
The volume is 10 cubic centimeters.
[tex]m=89.6 \ g\\v= 10 \ cm^3[/tex]
Substitute the values into the formula.
[tex]d=\frac{89.6 \ g }{10 \ cm^3}[/tex]
Divide.
[tex]d=8.96 \ g/cm^3[/tex]
The density of copper is 8.96 grams per cubic centimeter.
What term describes the strings of ribosomes that are attached to an RNA transcript at one time?
A. release factors
B. spliceosomes
C. transcription factors
D. mutagens
E. polyribosomes
Answer:
Polyribosomes.
Explanation:
During translation, the subunits of a ribosome surround the transcript and read down stream until they reach the start codon and begin polypeptide synthesis. Once the start codon is exposed, it is available for another ribosome to form around it, thereby initiating another locale for translation. Together the strings of ribosomes are called polyribosomes.
A line passes through the points( -3,-4) and (6,2)
Answer:
y = ⅔x - 2
Explanation:
We can solve for a linear equation of a line that passes through these two points by the elimination method and then substitute.
We simply write these two points in the form y = mx + c, where m is the gradient and c is the y-intercept (offset). So:
-4 = -3m + c
2 = 6m + c
____________ -
We can first eliminate c to solve for m and then substitute m back into either equation to solve for c. (See attached image for solving steps)
Then, we get:
m = ⅔
c = -2
so y = ⅔x - 2
Can someone help me with this question please?
Answer:
B
Explanation:
They use echolocation (sound waves) because they cannot see the bottom of the ocean.
Good luck!
Give the mRNA strand for the following DNA strand: ATACGATA
A. TATGCTAT
B. UAUGCUAU
C. TUTCGAUA
D. UATGCUAT
Answer:
every t is changed to u, the rest is the same.
Explanation:
B. UAUGCUAU
Which example has the most kinetic energy a football resting on a kicking tee a hurt football player sitting on the bench a football flying through a goal post a penalty flag on the ground
Answer:
The football flying through the goal
Explanation:
Kinetic energy is basiaclly moving energy. Since only the football going through the goal is moving, that's the one with the most kinetic energy.
(2) Which of the following describes the movement of particles down/ with a concentration gradient and how ?
Question options:
a)
Osmosis
b)
active transport
c)
diffusion
d)
both osmosis and diffusion
Answer:
Both osmosis. And diffusion
human rights violated when George Floyd was apprehended
Answer:
tell me how to answer it
Blood has a lower concentration of hydrogen ions than cellular cytoplasm. What does that tell us about the pH?
Answer:Acids and bases In the human body, both blood and the cytosol (watery goo) inside of cells have pH values close to neutral. ... A base, in contrast, raises pH by providing hydroxide (OH −start superscript, minus, end superscript) or another ion or molecule that scoops up hydrogen ions and removes them from solution.
Explanation:
Which statement below does NOT correctly describe water's chemical
properties?
a. Water is a neutral substance - it is neither a base or acid
b. Water is an inert substance
c. Water is not flammable or combustible
d. Water is reactive and catalyzes many reactions that take place inside living things
Answer:
b.
Explanation:
This is incorrect, because, "water is a powerful accelerator of chemical reactions."
Credit to www.astronno.com
Which best describes the process of insertion?
A.occurs when part of a chromosome breaks off and is placed into the middle of another chromosome
B.occurs when part of a chromosome breaks off and reattaches backward on the same chromosome
C.occurs when part of a chromosome breaks off and does not reattach
D.occurs when part of a chromosome breaks off and attaches to another chromosome
Answer:
A.occurs when part of a chromosome breaks off and is placed into the middle of another chromosome
Explanation:
Edge 2020
Answer:
A
Explanation:
EDGE2021 :-)
Have a nice day! ^-^
EASY 7TH GRADE SCIENCE FIRST PERSON MARKED BRAINLIEST!!!!
Which information does a student need to differentiate between the speed and the velocity of a vehicle in motion
A. The rate of the motion
B. The direction of the motion
C. The change in the amount of motion
D. The amount of distance traveled during motion
Answer: The action from a force can cause an object to move or can speed up accelerate, to slow down (decelerate), to stop, or to change direction. Since any change in velocity is considered acceleration, it could be said that a force on an object results in the acceleration of a object.
Explanation:
Answer:
(B) The direction of the motion
Explanation:
Which cellular process breaks down simple sugars to release energy?
O A. mitosis
O B. photosynthesis
O C. respiration
O D. waste elimination
Answer:
C. respiration
Explanation:
GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were
Answer:
u want step by step?
Explanation:
Graves’ Disease is an autoimmune disorder that causes an overproduction of the hormone produced in the thyroid. These hormones are responsible for cellular metabolism. What would this disorder probably result in?
Answer:
Explanation:
Graves' disease is an autoimmune disorder in which antibodies produced by your immune system stimulate your thyroid to produce too much T4. It's the most common cause of hyperthyroidism. Hyperfunctioning thyroid nodules (toxic adenoma, toxic multinodular goiter or Plummer's disease).
Which statement correctly describes transpires during a chemical reaction?
Answer:
Melting but if it is radiactional is evaporating
Open Response 2 part A: Plant cells and fungal cells have many of the
same types of organelles. Structures X and Y are found in both plant cells
and fungal cells. Structure Z is found in plant cells, but not in fungal cells. A
- What is party?
X
Z
What happens to red blood cells when placed in a hypotonic solution?