Answers
both species had growth in number within the same time period
Related Questions
4. When an offspring grows off from the body of a parent organism it is called __________________. *
a.fission
b.budding
c.fragmentation
d.sporulatioin
Answers
Answer:
Budding
Explanation:
It is asexual reproduction in which offspring grows out of the parents organisms.
In the process of budding, an offspring grows off from the body of a parent organism and buds off when fully matured. Thus, the correct option is B.
What is Asexual Reproduction?
Asexual reproduction is the type of reproduction only a single parent is involved. In this process, offspring are developed from a single parent called mother cell and these offspring are genetically identical to the parent hence are also called as clones.
During the process of budding which is a types of asexual reproduction, a new organism develops from an outgrowth or bud which is formed on the parent plant due to the cell division at a particular site on the parent plant. For example, the small bulb-like projections coming out from the yeast cell are the buds which give rise to new yeast organism.
Therefore, the correct option is B.
Learn more about Asexual Reproduction here:
https://brainly.com/question/4100787
#SPJ6
A repressor prevents
a. translation from occurring.
b. ribosomes from binding to mRNA
c. transcription factors from binding to DNA
Answers
Which fossils provide information as to the mode of formation of an oxygen-rich atmosphere by about 2 billion years ago?
Answers
Answer:
The fossils that provide information on the formation of an oxygen-rich atmosphere are the stromatilites from the Precambrian era. These are layered and columnar fossils consisting mainly of cyanobacteria which were the original life form back then. These bacteria took in carbon dioxide and produced oxygen by photosynthesis as early as 2.5 billion years ago (the earth is about 4.5 billion yrs old).
Explanation:
What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
Answers
Answer:
what I don't understand what is the Ctcagt
help idk this answer
Answers
Answer:
d
Explanation:
Please hurry I’m being TIMED
The smaller the load a river has the more sediment it can carry.
Please select the best answer from the choices provided
T
F
Answers
Answer:
true
The smaller the load a river has the more sediment it can carry. TRUE.
Answer:
this is true
Explanation:
i just took the test
A baseball is tossed into the air, forming an arc. Mark the following points:
1. Kinetic energy is the highest
2. Potential energy is the highest
3. Kinetic energy is converted in potential energy
4. Potential energy is converted into kinetic energy
Answers
Answer:
it is number 3 .............
Answer:
Kinetic energy is the highest when the baseball is in the air.Potential energy is the highest when the ball is about to be thrown.Kinetic energy gets converted to potential energy when the ball stops flying in the air and falls on the ground.Potential energy is converted into kinetic energy when the ball is thrown.SOMEONE PLZ HELP!!!!!!!!!!!!!
Answers
Answer:
Eukaryotic cells probably evolved about 2 billion years ago. Their evolution is explained by endosymbiotic theory. Mitochondria and chloroplasts evolved from prokaryotic organisms. Eukaryotic cells would go on to evolve into the diversity of eukaryotes we know today.
Hope this helps.
Explanation:
Answer:
Eukaryotic cells :)
Explanation:
Which categories of amino acid would you expect to find on the surface of a soluble protein, and which would you expect to find in the interior? What distribution of amino acids would you expect to find in a protein embedded in a lipid bilayer?
Answers
Answer:
Polar and charged amino acid residues (the remainder after peptide bond formation) are more likely to be found on the surface of soluble proteins where they can interact with water, and nonpolar (e.g., amino acid side chains) are more likely to be found in the interior where they are sequestered from water.
Explanation:
The amino acids with POLAR and CHARGED side chains are expected to be observed on the membrane surface, whereas amino acids with NON-POLAR and HYDROPHOBIC side chains are expected to be found inside the lipid bilayer.
The lipidic bilayer is mainly composed of phospholipids.Phospholipids have hydrophilic, polar phosphate heads facing out on each surface to interact with water and hydrophobic fatty acid tails facing each other inside the lipid bilayer.The polar and charged side chains of amino acids are expected to be observed on the surface of membrane proteins because they can interact with water (H2O) molecules.On the other hand, nonpolar side chains of specific amino acids are expected to be observed inside the lipid bilayer to interact with the hydrophobic fatty acid tails of phospholipids.The polar amino acids include glutamine, glutamic acid, arginine, asparagine, aspartic acid, histidine, lysine, serine, and threonine.Moreover, amino acids with hydrophobic side chains include leucine, isoleucine, glycine, alanine, valine and proline.In conclusion, amino acid residues with POLAR and CHARGED side chains are expected to be observed on the membrane surface, whereas amino acids with NON-POLAR and HYDROPHOBIC chains are expected to be found inside the lipid bilayer.
Learn more in:
https://brainly.com/question/4535258?referrer=searchResults
T/F Osmosis and diffusion are both examples of passive transport.
A.True
B.False
Answers
Both osmosis and diffusion are passive transport processes, meaning that no additional energy is needed for them to take place. In both diffusion and osmosis, particles move from an area of higher concentration to one of lower concentration.
The given statement "Osmosis and diffusion are both examples of passive transport" is True.
Passive membrane transfer methods are the most direct. Passive transport is a phenomena that happens spontaneously and doesn't require the cell to use energy to move. Diffusion is the process by which chemicals travel passively from a region of higher concentration to a region of lower concentration. A concentration gradient is a difference in the concentration of one substance throughout a physical region.Transport that is done passively is called diffusion. Until the concentration is the same across the space, a single substance has a tendency to travel from an area of high concentration to an area of low concentration.Based on the gradient of water concentration across the membrane, osmosis is the mechanism by which water diffuses through a semipermeable membrane. Osmosis moves just water across a membrane, and the barrier restricts the diffusion of solutes in the water, whereas diffusion distributes material across membranes and into cells.Learn more about the passive transport with the help of the given link:
https://brainly.com/question/1619908
#SPJ1
A colleague has used computer modeling to design an improved enzyme. To produce this enzyme, the next step is to:___________.
A) look for a bacterium that makes the improved enzyme.
B) mutate bacteria until one makes the improved enzyme.
C) determine the nucleotide sequence for the improved enzyme.
D) synthesize the gene for the improved enzyme.
E) use siRNA to produce the enzyme.
Answers
Answer:
C) determine the nucleotide sequence for the improved enzyme.
Explanation:
Computational enzyme design (CED) can be defined as a bioinformatic in silico approach used to model, construct, and enhance enzyme catalysis. CED uses complex optimization algorithms that enable to direct evolution by using computational systems. As a further step, after the modelization of optimal enzymatic activity, bioinformaticians require to determine the nucleotide sequences which will be subsequently used to synthesize the corresponding enzymes.
What affect do glass panels have on temperature google doc
Answers
Answer:
wdym
Explanation:
What are internal structures?
Answers
Answer:
Internal structures are the inner pieces and parts that keep organisms alive, help them grow, and help them reproduce.
Explanation:
can somebody do 4 and 5 for me
Answers
Answer:
4. According to what is observed in the diagram, the maltose (substrate) binds to the maltase (enzyme) to obtain glucose molecules (product), in a process of hydrolysis of the maltose.
5. Three factors that can affect intestinal maltose activity - slowing it down or stopping it - are temperature, pH and substrate depletion.
Explanation:
4. Enzymes, such as maltase, have the function of making a reaction faster and decreasing the activation energy. Maltase is responsible for breaking down a maltose molecule, a dimer, into two glucose monomers, which is a hydrolysis reaction of the bonds that hold glucose molecules together.
5. There are several factors that can cause the decrease or cessation of the activity of an enzyme. Enzymes are activated when substrate is available and work best under ideal temperature and pH conditions. When there are alterations of these factors, the enzyme will reduce or stop the reaction in which it intervenes.
pH: when the pH increases or decreases it produces a decrease in the speed of reaction that catalyzes an enzyme. Very high or low pH levels can denature the enzyme and make the expected reaction not occur. Temperature: like pH, changes in temperature can slow or stop maltase activity. Substrate availability: It is a fact that when the specific substrate of an enzyme becomes depleted, the rate of reaction slows down, stopping when no substrate is available.Which types of mutations in the lac operon stop Escherichia coli from utilizing lactose as a carbon source? a) promoter deletion b) lactose-binding site mutation c) repressor DNA-binding site mutation d) operator deletion
Answers
Answer:
D.) repressor DNA-binding site mutation
Explanation:
lacl prevents the repressor polypeptide is a mutant that prevent operon from binding lactose, and thus will bind to the operator and be non-inducible.. This mutant will represses the lac operon whether lactose is present or not and the lac operon will not be expressed. It is also called“super-supperesor".
The lacI locus – One type of mutant allele of lacI (callled I-) prevents the production of a repressor polypeptide or produces a polypeptide that will not allow to bind to the operator sequence.
This is also a constitutive expresser of the lac operon because absence of repressor binding permits transcription.
Identify the three types of neurons, and explain the function of each type
Answers
Answer:
Sensory neurons help you:
taste
smell
hear
see
feel things around you
Explanation:
Motor neurons
Motor neurons play a role in movement, including voluntary and involuntary movements. These neurons allow the brain and spinal cord to communicate with muscles, organs, and glands all over the body.
Interneurons
Interneurons are neural intermediaries found in your brain and spinal cord. They’re the most common type of neuron. They pass signals from sensory neurons and other interneurons to motor neurons and other interneurons. Often, they form complex circuits that help you to react to external stimuli.
Explain how photosynthesis and cellular respiration work together.
Answers
Answer:
photosynthesis converts carbon dioxide and water into oxygen and glucose. Glucose is used as food by the plant and oxygen is a by-product. Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process.
What methods would the body use to provide a
person with energy throughout a race?
DONE
C
Intro
Answers
Answer:
The methods the body would use to provide a person with energy throughout a race is using the ATP in the muscle cells for the first 3 seconds.
For the next 8 to 10 seconds, the body replaces the used ATP and produces more.
Within the next 90 seconds of the race, anaerobic respiration is used up to make more ATP (Adenosine triphosphate).
Therefore, during the whole process, the three energy systems used are:
the ATP-PC System
the Glycolytic system
the Oxidative system
Answer:
The methods the body would use to provide a person with energy throughout a race is using the ATP in the muscle cells for the first 3 seconds.
For the next 8 to 10 seconds, the body replaces the used ATP and produces more.
Within the next 90 seconds of the race, anaerobic respiration is used up to make more ATP (Adenosine triphosphate).
Explanation:
The process of desalination removes salt from seawater using condensation methods or filtration. Which of the following is least likely to be a problem for widespread use of desalination?
A. To be economical, desalination plants must be build on coastlines
B. Desalination uses large amounts of energy
C. There is a shortage of seawater to use for desalination
D. Desalination is relatively slow
Answers
There is a shortage of seawater to use for desalination.what's the answer
What structure would not be found in a cell from human skin
Answers
Answer:
chloroplast i think , i may b wrong
What type of cloud is Cloud A? What kind of weather might you expect when you see clouds of this type?
Answers
Answer:
Cloud A is a cumulus cloud. When these fluffy, white clouds are in the sky, you can expect fair weather.
Explanation:
What are de clinical sings in equine sinovitis
Answers
Clinical signs include fetlock joint effusion, firm swelling over the dorsoproximal aspect of the fetlock joint, lameness, and decreased range of motion and a positive response to firm flexion of the fetlock. Diagnosis can be suspected by palpation
which best describes the results of mendels work with pea plants a) he figured out the fastest way to grow pea plants. b) he showes that pea plants do not pass traits to their offspring. c) he found the basic ideas about genetics. d) he discovered the scientific method.
Answers
Answer:
its C
Explanation:
most bacteria reproduce by
Answers
Answer: Most bacteria rely on binary fission for propagation.
Explanation: Hope this helps have a great day!
Answer: Most bacteria reproduce by binary fission, also know as propagation.
Which of these will weigh the same after it has undergone a change?
A.) Paper being burned.
B.) Sugar water being evaporated.
C.) Two chemicals reacted to form gas.
D.) Ammonia added to steel wool to create heat.
Answers
1. Compare and contrast mitosis and meiosis. 2. What major event occurs during interphase?
Answers
Answer:
1.
contrast between mitosis and meiosis
Mitosis
- it takes place in somatic cells in multi cellular organisms in order to provide growth, however, in unicellular organisms it is reproductive division as well. is the means of reproduction in single-celled organisms. Other organisms use it for the growth of tissues (somatic cells)
- exact number of chromosome in offspring
- no recombination or crossing over
- no pairing found
- major phase: prophase, metaphase, anaphase, telophase
Meiosis
- takes place in sex cells to form gamete formation during sexual reproduction
- half of the chromosome number found in gametes of the parents thus, known as reduction division
- due to crossing over takes place recombination found.
The pairing of chromosomes takes place
- major steps:
Meiosis 1 – prophase, Metaphase, anaphase, Telophase, and
Meiosis 2: Prophase, Metaphase, Anaphase, and Telophase
2. Interphase takes place prior to both mitosis and meiosis which is divided into 3 sub phases-G1, S and G2 phases.
The major events are as follows:
G1- RNA and protein synthesis takes place and cell grows in size
S- DNA replication takes place, Centriole duplication occurs and synthesis of histone proteins.
G2- RNA and Protein synthesis continues.
Which cell organelle is most responsible for ensuring that the cell obtains the necessary materials to maintain homeostasis?
Answers
Answer:
i’d say mitochondria
Explanation:
mitochondria is the “powerhouse of the cell”
Explain how exercise and an active lifestyle can improve bone health
and bone density.
Include discussions of osteoblasts vs.
osteoclasts, osteoids, osteocytes, collagen, bone modeling, impact
and increased workload, glucocorticoid effects, mineral intake, or
underloaded bone.
Answers
Explanation:
explain how exercise and an active Lifestyle can improve bone health and bone density include discussions of
Higher energy contained in the sugar molecules produced by photosynthesis comes from
A. light
B. water molecules.
C. ΑΤΡ.
D. carbon dioxide molecules.
Answers
Answer:
A
Explanation:
light
ffjcddssdfghcxdsssswefgcfdd
What is the contour interval of this map?
Answers
Answer:bird creek
Explanation: