Burning a book easy explanation

Answers

Answer 1
Book burning is the deliberate destruction by fire of books or other written materials, usually carried out in a public context. The burning of books represents an element of censorship and usually proceeds from a cultural, religious, or political opposition to the materials in question.

Related Questions

The above was written in 1788 by an Anti-Federalist. Which statement best describes the author's position on the judiciary?

Answers

Answer:

He believes federal judicial power will restrict states' rights.

Explanation:

I took the test

Am I correct? Pls answer ASAP!

Answers

Answer:

not that or rosseta stone so most likely code of hammurabi

Explanation:

rosseta stone= egyiptian artifact for language

ten commandments= are from god

Answer:

i think you are correct,but if not it could also be a

Explanation:

What was a deity in the religion of ancient Greece?

a god
an oracle
a religious leader
a religious follower

Answers

A) a god
Explanation: Deities are also known as gods for example: Zeus is a deity , he is the god of the Sky and Lightning

A god was a deity in the religion of ancient Greece. Thus, option A is correct.

What is a religion?

A religion is a collection of beliefs and customs. It comprises laws, narratives, and rituals that a nation, a club, or an individual adopts. Religion can be a method of living or a quest for understanding the hereafter. A set of people's fervent views and beliefs that also are expressed in anticipated beliefs and attitudes are known as a religion.

Deities are indeed referred to as gods, such as Zeus, the goddess of the heavens and thunderbolt. Any mysterious force revered as having power over a certain region of the planet, a certain level of life, or who represents a certain force. The people's belief in these gods was very high.

Therefore, option A is the correct option.

Learn more about religion, here:

https://brainly.com/question/1463373

#SPJ6

bebop was a reaction against what type of music

Answers

Answer:

jazz Style

Explanation:

which country became the centerpiece in the European countries

Answers

Most likely Britain as it is a major country with a economic policy and trade agreements that are the backbone of the European economy.
Answer:I think it is Britain

Answer
Get 100 points

Answers

Answer:

Food Shortages - Moved to south

Too much or too little rain - built an irrigation system

Attacks by neighboring communities - built walls and moats

Irrigation system crossed village boundaries - worked together for the common good (keep water system moving)

Explanation:

1) Driven by the need for food, they searched elsewhere

2) They store that extra rain in an irrigation system to use for when there is little rain.

3) They defended themselves from neighboring communities attacking them by building walls and moats.

4)  They kept the water system moving.

I would like to apologise in advance if any of these are incorrect.

Answer:

May you have the best 2021 ever!

Explanation:

Thank you!

The world was possibly minutes away from nuclear war when _____.

an American plane was shot down
a Soviet Union nuclear submarine emerged off the east coast of the United States
America threatened retaliation from Eastern Europe
Cuba was attacked by the Soviet Union

Answers

Answer:

Option: an American plane was shot down

Explanation:

In the 1960s, the Soviet Union shot down a U-2 spy plane and captured Pilot Gary Francis Powers. The United States denied the aircraft used for surveillance. The Soviet, with the capture of the pilot and wreckage, declared part of the CIA. At last Dwight D. Eisenhower forced to admit that it had been spying on the Soviet. Tensions from the incident were high when Eisenhower and Russian leader Nikita Khrushchev arrived in Paris to begin a summit. Khrushchev wasted no time in blaming the United States.

Answer:

A. an American plane was shot down

Explanation:

got it right on edge

Pls help me on this.

Answers

Answer:

the answer is gold, silk, and spices I think

Answer:

silk and spices

Explanation:

Before the Industrial Revolution in the mid-to-late 19th century, demand for oriental goods such as (porcelain, silk, spices, and tea) remained the driving force behind European imperialism.

According to the law of supply, sellers are likely to reduce their supply of a
good when:
A. the good's selling price has gone up.
B. the public demand for the good has gone down.
C. the good's selling price has gone down.
D. the public demand for the good has gone up.

Answers

Answer:

c

Explanation:

Why would the English Parliament want to place such limits on the monarch?

Answers

Hey you still need help with this?

PART B: Which phrase from the paragraph best supports the answer to Part A?
A. "lying supinely on our backs"
B. "hugging the delusive phantom of hope"
C. "which the God of nature has placed in our power"
D. "Three millions of people, armed in the holy cause of liberty"

Answers

Answer:

D

Explanation:

Answer:b

Explanation:valid

Define bourgeoisie in one sentence

Answers

Answer:

Bourgeoisie definitions

The social class between the aristocracy or very wealthy and the working class, or proletariat; middle class. ... In Marxist doctrine, capitalists as a social class antithetical to the proletariat.

Explanation:

What was the the governing body of England.
*
O Monarchy
B
Parliament

Answers

Answer: Parliament

Explanation: The Parliament of the United Kingdom of Great Britain and Northern Ireland (commonly known as the UK Parliament, the British Parliament) is the supreme legislative body for the United Kingdom and also for English Law.

What does 666 stand for?

Answers

Answer:

Demonic Number

Explanation:

What was the name of the ancient Egyptians’ form of written language? alphabet hieroglyphics papyrus pictograph

Answers

Answer:hieroglyphics

Explanation::)

Answer:

hieroglyphics

Explanation:

hieroglyphics were written on papyrus.Hope i could help<3

What did Texas v. Johnson teach you about the first Amendment? *

Answers

Answer:

Texas v. Johnson

Explanation:

In Texas v. Johnson, 491 U.S. 397 (1989), the Supreme Court struck down on First Amendment grounds a Texas flag desecration law. The 5-4 decision has served as the center point of a continuing debate regarding the value of free speech as exercised through the burning of the U.S. flag as a form of political protest. The first amendment covers "no law respecting an establishment of religion, or prohibiting the free exercise thereof; or abridging the freedom of speech, or of the press; or the right of the people peaceably to assemble, and to petition the Government for a redress of grievances." - https://constitution.congress.gov/

How did the second Great Awakening influence change in American society?
It led to industrialization by encouraging people to become wealthy
It brought about a closer relationship between church and state
O it inspired the growth of reform movements
It encouraged Southerners to assert their rights by seceding

Answers

Answer:

The Second Great Awakening, which spread religion through revivals and emotional preaching, sparked a number of reform movements. Revivals were a key part of the movement and attracted hundreds of converts to new Protestant denominations. The Methodist Church used circuit riders to reach people in frontier locations.

Explanation:

Answer:

It inspired the growth and reform movements.

Explanation:

The first great awakening was very religious and the second one inspired unity among the states.

Kings granted favors to merchants in exchange for taxes
True or False

Answers

The answer is True...

Answer:

true

Explanation:

PLS HELP With this Question!!!

Answers

Answer:

I'm pretty sure it's D

(sorry if I get it wrong)


How did the War of 1812 change the United States?
A. It cut off the United States from global trade.
B. It helped shape a growing U.S. national identity.
C. It ended slavery in most of the United States.
D. It led to the fall of the Democratic Republican Party.

Answers

Answer:

B. Helped change the compostion of the US -new oppurtunities for westerd expansion led to growth in territory and population.

Explanation:

Answer:

b

Explanation:

plz help me!!!!!!!!

uring an archaeological dig, an ancient object known to be from civilization A was found on the other side of the border in civilization B. Which two of the following hypotheses can be made based on this discovery?

Civilization A spied on the developments of civilization B.

Civilization A participated in trade with civilization B.

Civilization B did not get along with civilization A.

Civilization B stole objects from civilization A.

Civilization A was studying the achievements of civilization B.

Answers

Answer:

Civilization A participated in trade with civilization B.

Civilization B stole objects from civilization A.

Explanation:

Russian front ? What is the definition

Answers

The Eastern Front of World War II was a theatre of conflict between the European Axis powers and co-belligerent Finland against the Soviet Union, Poland and other Allies, which encompassed Central Europe, Eastern Europe, Northeast Europe, and Southeast Europe from 22 June 1941 to 9 May 1945.

Anyone know the answer to these I’m stuck

Answers

the questions are too small i don’t think anyone can see it please make it bigger

CAN SOMEONE HELP ME ASAP

Which text was used to support a strict interpretation of the Constitution regarding the powers allowed Congress?
the Tenth Amendment
Gazette of the United States
Washington's Farewell Address
"Necessary and proper" clause

Answers

Answer:

the tenth amendment

Explanation:

The Tenth Amendment's simple language—“The powers not delegated to the United States by the Constitution, nor prohibited by it to the States, are reserved to the States respectively, or to the people”—emphasizes that the inclusion of a bill of rights does not change the fundamental character of the national government.

Who serves as the Commander-in-Chief of the U.S. military?

A. President
B. Vice President
C. Secretary of State
D. Secretary of defense

Answers

Answer:

B

Explanation:

I think

A the president he has the right to say what happens with anything

The orginal constitution that was written in 1787 and signed by____men.was made up of the preamble and ____

Answers

Answer:

delegates

seven Articles,

Explanation:

What effect does the Free Homes Act of 1900 have on you?
A. All of your land debt is absolved, except for your filing fee.
B. All of your land becomes a government-owned cooperative,
C. All of your land will be cared for by American Indians.
D. All of your land will stop being taxed, freeing resources for irrigation,

Answers

Answer:

D

Explanation:

The Free Homes Act saved settlers in Oklahoma an estimated $15 million. Those who stayed on their claims for five years saved on average four hundred to five hundred dollars, money they used to improve houses and outbuildings, purchase livestock and equipment, and prove up their homesteads.

Answer:

d i think

Explanation:

20 POINTS!! Explain why a belief in witchcraft may help maintain order in society.
pls help me I have to turn this in soon.

Answers

Answer:

Witchcraft is the practice of magic, especially black magic; the use of spells and the invocation of spirits. If said magic could make everybody whom is making society not maintained "disappear" or contribute to help society stable... I think so

Explanation:

Which statement summarizes a belief of the Republican Party?

Answers

The available options are:

A. There should be higher taxes and more public services.

B. State and federal elections should be held more frequently.

C. Taxes should be lowered even if this means fewer public services.

D. The U.S. House of Representatives is more important than the Senate.

Answer:

Taxes should be lowered even if this means fewer public services.

Explanation:

Republicans generally hold the opinion or notion that tax should be lower. In other words, Republicans support various tax cuts, including the abolition of the death tax.

This was evident during the administration of President Bush with his Bush Tax Cut.

For examples The Economic Growth and Tax Relief Reconciliation Act of 2001 and The Jobs and Growth Tax Relief Reconciliation Act of 2003

Answer:

Taxes should be lowered even if this means fewer public services.

I really need help what is the answer for 32 and 33 I will mark brainliest!!!

Answers

where is the questions 32 and 33?
Where are they?we don’t see them
Other Questions
PLEASE HELP!! 15 Points for CORRECT ANSWER ( nOT POINT D) THANK YOU AND BRAINLIEST A paired t-test can be treated as an inference about the mean of differences between two experimental conditions for a single sample of independent subjects.A. TrueB. False 12 13 14 Qu frase es incorrecta? De nio, el hombre siempre jugaba en la selva. Carlos y Sofa vean muchas cosas interesantes and Costa Rica la semana pasada. Cuando yo era joven, yo miraba la tele de vez en cuando. Open Response 2 part A: Plant cells and fungal cells have many of thesame types of organelles. Structures X and Y are found in both plant cellsand fungal cells. Structure Z is found in plant cells, but not in fungal cells. A- What is party?XZ HELP PLEASE PLEASE PLEASE!!The function f(x) = 4x 8 is reflected across the y-axis, resulting in a new function, g(x). Write the EQUATION of g(x). Please show how you got it!!! are the triangles congruent? if they are, state how they are congruent. Plz help!In order for the parallelogram tobe a rectangle, x = [? ]13x+34910x+10 How will you display the contribution in your museum Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists?