Factor – 1/2 out of -1/2x+6

What is the factored expression of this

Answers

Answer 1

Answer:

-1/2(x-12)

Step-by-step explanation:

Since you need to factor -1/2 out of the given expression, you can say that

-1/2x+6 is equal to

-1/2(x-12)

Answer 2

Answer:  [tex]-\frac{1}{2}(x-12)[/tex]

==================================================

Explanation:

The terms of [tex]-\frac{1}{2}x+6[/tex] are [tex]-\frac{1}{2}x[/tex] and [tex]6[/tex]

Divide each term by -1/2 to factor out the -1/2

If we divide [tex]-\frac{1}{2}x[/tex] over -1/2, then we'll get x. Basically the -1/2 terms cancel.

If we divide 6 over -1/2, we get -12. It might help to think of it as 6/(-0.5) = -12.

So overall we have [tex]-\frac{1}{2}x+6 = -\frac{1}{2}(x-12)[/tex]

You can use the distribution property to check the answer.


Related Questions

HELP PLS ANSWER
Which set of ordered pairs represents a function?

Answers

Answer:

the answer is d

Step-by-step explanation:

the x values don't repeat so therefore It is a function.

Answer:

D

Step-by-step explanation:

It's D bc you can have two of the same inputs equaling differnt outputs. You could of it as 4+3 = 7, 9, 2, and 1 or whatever numbers, its not true it only equals 7. Hope that helps

If a car is moving 50 mi/hr and travels 30 miles, how long did the journey take?

Answers

Answer:

36 minutes

Step-by-step explanation:

1 hour = 60 minutes

[tex]\frac{50}{60} = \frac{30}{m}[/tex]

50m = 1800

m = 36 minutes

The Journey will take 6 hours.

What is speed distance formula?Speed = Distance/Time Distance = Speed X TimeTime = Distance / Speed.

Given:

speed = 5 mph

Distance = 30 miles

So, speed = Distance / time

5 = 30 / time

time = 30/5

time = 6 hour.

Hence, the journey take 6 hour.

Learn more about speed- distance here:

https://brainly.com/question/10566304

#SPJ2

plz help I need this now

Answers

Answer: 1 30.0

3 20

2 8

Step-by-step explanation:

Can you help me?
(Only answer if you know)

Answers

Answer:

it is Q4

Step-by-step explanation:

not sure how to explain it

Is this right? I chose 0.25. The other answers are 4, 0.5 and 2.

Answers

Answer:

its 0.25 or 2 one of those

Step-by-step explanation:

most likely 0.25 but

Evan's science class placed some metal balls on a scale. They used a red ball that weighed 5/13 of a pound, a yellow ball that weighed 10/17 of a pound, a green ball that weighed 5/13 of a pound, a blue ball that weighed 4/13 of a pound, and a gray ball that weighed 6/17 of a pound. What was the total weight of the metal balls?

Answers

Answer:

2 4/221 = 2.018

Step-by-step explanation:

5/13+10/17+5/13+4/13+6/17 = 2 4/221 = 2.018

What is the simplified form of this expression?

7a2 + 10a − 3a − 2a2

Answers

Answer:

What is the simplified form of this expression?

7a2 + 10a − 3a − 2a2

Step-by-step explanation:

7a2 + 10a − 3a − 2a2

Combine like terms

742 + 10a - 3a - 2a2

742 + 7a - 2a2

solution=

5a2 + 7a

5a2+7a
explanation
just add like terms

Please answer this question

Answers

B.


The answer would be B. since the scale factor is smaller then 1 it would be a reduction.
B. I just got done with the test and b is the right answer

Javier's monthly net income is $1,500 . He requests that his bank deposit 1/5 of his monthly earnings into his savings account . How much money per year will Javier contribute to his savings account ?

Answers

Answer:

1500 * 1/5

1500 * 0.2 = 300

300 * 12 = 3600

Javier contributes $3,600 a year to his savings.

Step-by-step explanation:

Answer:

$3600

Step-by-step explanation:

1,500 x 1/5 = 300. This is how much money gets put into his savings account every month.300 x 12 = 3600

During the summer, Sarah picks watermelons for her uncle. The table shows the number of wagon loads, x, and the number of watermelons Sarah can haul, y. What is the unit rate in watermelons per wagon load?
A) 2 B) 4


C) 8 D) 16

Answers

Answer:

C

Step-by-step explanation:

Unit rate is watermelons/wagon load in this situation.  Wagon load must be 1 and the table says 1 wagon load: 8 watermelons.

Hope this helps!  Have a nice day!

30° is used in a pie chart to represent 5 people. How many people were there altogether???

Answers

Answer:

60

Step-by-step explanation:

here are 360° used in a whole pie chart

Using proportion

30° → 5 people

360° → 5 × 360 / 30 = 5 × 12 = 60

There are 60 people altogether

its 60 dhdkshdshbzzh

A class party was attended by 80% of the students. If there are 60 students in the class, how many attended the party?​

Answers

Answer:

48 students

Step-by-step explanation:

Answer: 48

Step-by-step explanation: 80% of 60 is 48 students

I need help with this ASAP!!!!!!!!!!!!!!

Answers

Answer:

Step-by-step explanation:

Part A and B Please 10 points

Answers

For part a I would say you can’t use that translation to change it back to the original triangle. I tried the rule out for myself


My coordinate was 3, 6 and applied the -7 -6 rule and got -4,0.

Then I used the rule that they have to translate it back which was -6 -7 and there’s no way it can be translated back to 3, 6

So the answer is no the rule can’t be used to translate it back


Can you mark branliest
same thing the person above said

The number of cans the soup kitchen has is represented by the equation, y = -63x + 825, where x represents the number of days and y represents the number of cans. How many cans will the soup kitchen have left after 10 days? Which statements are true based on the equation given. Select all that apply.

A Nicholas had 235 cans at home.
B The school collected 235 cans a day.
C Nicholas had 15 cans at home.
D The school collected 15 cans daily.

Answers

The answer is B for sure

I NEED HELP THIS IS DUE IN AN HOUR!!!!!

Answers

B = 1
W = 28
unless theres more info
B = 1

W = 28


Explanation:

k + 9 = 17

What does k value?
k=8
k=9
k=17
k=26

Answers

Answer:

8

Step-by-step explanation:

k + 9 = 17

subtract 9 from both sides:

k = 8

Answer: k=8 so I guess A haha

Step-by-step explanation:

you would just subtract 9 from each side so 17-9= 8 and boom.

You’re welcome :)

PLEASE HELP!!!
Which expression is the factored form of−4.5n+3?

−1.5(3n+2)

−3(1.5n+1)

−3(1.5n−1)

−1.5(−3n+2)

Answers

Answer:

-3(1.5n - 1)

your welcome

the third one -3(1.5n-1)

Hello people kinda need help with this question below...

Answers

Answer:

X is increasing by 2 and Y is decreasing by -3. : )

Answer:

X = 2

Y = -3

Step-by-step explanation:

The X values increase by two, so that's a plus 2

The Y values decrease by three, so that's negative 3.

Jamie wants to paint a wall in his bedroom. Not only does he need to buy paint, but he also needs to buy tape to tape off all side of the wall and the window. How many feet of painters tape will jamin need to buy (assume no overlap)? note the wall and the window are both rectangle.
IMPORTANT: i cant give you a picture but on brainly there is a picture of it but the ending of the question says how many square feet is jamin planning to paint? so plz use that picture thanks these are the multiple choise answers
a. 17.5 ft
b. 35 ft
c. 28 ft
d. 21 ft

Answers

Answer: im pretty sure its 35ft

Step-by-step explanation:

Answer:

35ft

Step-by-step explanation:

ANYONE GOOD AT HISTORY!?

Answers

Answer:

BRAINLIEST PLSSS

Step-by-step explanation:

im good

Please help this is due tmr, Don't answer the question if you have no answer or ideas. Im not trying to be rude but I really just need help. :(

Think about how you can use absolute value notation to express the distance between two points on a coordinate graph. For each pair of points below, find the distance between the given points and express your work using absolute value symbols. Explain or Show your work.


1. (4, 9) and ( –5, 9)

2. (7, –1) and (7, –4)

3. (0, 9) and (0, –7)

4. (4, –8) and (–10, –8)

Answers

Answer:

watch Khan academy video it should explain everything on absolute value and whatever else u need help with it has probably multiple videos for each unit in math

4 is the correct answer

Diana is painting statues. She has 7/8 of a liter of paint remaining. Each statue requires 1/20 of a liter of paint. How many statues can she paint?

Answers

Answer:

question is incomplete. A complete question is ----> Diana is painting statues. She has 7/8 of a liter of paint remaining. Each statue requires 1/16 of a liter of paint. find the number of statues.

each statue requires 1/16th of a liter of paint.

so, in a liter , 16th statues can be painted by Diana.

but A/C to question,

she has 7/8 of a liter of paint remaining.

so, we have to find how many statues she can paint in 7/8 litres.

so, number of statues = 7/8 × 16 = 14

Step-by-step explanation:

she can paint 10 statues! hope this helps! :)

Which is the scale factor proportion for the reduction?

Answers

The answer is B, hope this helps

Answer:

B

Step-by-step explanation:

The coldest recorded temperature in the United States is –80°F, in Alaska. The warmest recorded temperature in the United States is 134°F, in California. How much higher is the warmest recorded temperature than the coldest recorded temperature?

Answers

Answer:

214

Step-by-step explanation:

I think this is the answer x

Answer:

54ºF

Step-by-step explanation:

I got this by doing -80+135 and I got 54! Hope this helps! Have a great day! :)

$7.50 meal; 6.5% tax _____

Answers

Answer:

14.0

Step-by-step explanation:

$7.50 meal + your 6.5$ tax.

We add those and it will equal 14.00

We need to add 100% to it so now it's: 106.5%

Now we need to change it to a decimal and we do that by moving the decimal two spaces to the left.

106.5 = 1.065

We now multiply 1.065 and $7.50

7.50 × 1.065 = 7.9875

We need to round it so now it's $7.99

plz help quick. the sum of two numbers is 11. Three times the first number minus the second number is -3. what are the numbers? can i plz have work too?

Answers

Answer:

the first number is 2, the second number is 9 :)

I already answered this on your last question ;-;

Step-by-step explanation:

I wrote this on a piece of paper:

3 times ? minus ? = -3

And then I just kept replacing the question marks with what adds up to 11 until i got the answer lol.

The awnser is 5 because 3 times 5 is 15 minus 3 is 11

Pls help if these questions don’t get answered by tonight my “back” will never feel the same

A store owner has 7.11 lbs. of candy. If she puts the candy into 9 jars, how much candy will each jar contain?

What is the average speed in miles per hour of a car that travels 956.4 miles in 15.9 hours? Round your answer to the nearest tenth.

A member of the school track team ran for a total of 179.3 miles in practice over 61.5 days. About how many miles did he average per day?

38.86 divided by 3.9

Dividing decimals

Answers

Answer: 7.11/9=0.79 per jar

956.4/15.9=60.2 average speed

179.3/61.5=2.9 miles

38.86/3.9=9.964

Step-by-step explanation:

division and a calculator.

Answer:

It's can be Wrong, I hope it can help you!

Step-by-step explanation:

1) The store has 0.79 ibs in each jar.

2) The answer to the nearest tenth is 15,206.8

3) 2.915447154 miles did he average per day.

4) 9.964102564

A forest covers 33,000 acres. A survey finds that 0.8% of a forest is old-growth-tree. How many acres of old-growth-trees are there?

Answers

Answer:

264 acres

Step-by-step explanation:

Since 33,000 acres is 100%, 330 acres is 1% because 33000 acres divided by 100 is 330 acres. Then if 330 acres is 1%, 33 acres is 0.1% because 330 acres divided by 10 is 33 acres. 1 divided by 10 is 0.1.

Next 33 acres times 8 because 0.8% is eight times bigger than 0.01%. This equals to 264 acres.

MATH HELP!! What is the y-interpret of this line?

Answers

Answer:

B(0,2)

there was a y- intercept at the line.. u must see the point that intercept with y- axis

Answer: B. (0,2)

Step-by-step explanation: Look at where the line goes through the Y-axis. You can see it goes through the 2 on the y-axis so its (0,2)

Other Questions
2) There are 500 calories in 5 servings of SourPatch Kids. How many calories per serving?How many calories are there in 8 servings? PLEASE HELP!! 15 Points for CORRECT ANSWER ( nOT POINT D) THANK YOU AND BRAINLIEST A paired t-test can be treated as an inference about the mean of differences between two experimental conditions for a single sample of independent subjects.A. TrueB. False 12 13 14 Qu frase es incorrecta? De nio, el hombre siempre jugaba en la selva. Carlos y Sofa vean muchas cosas interesantes and Costa Rica la semana pasada. Cuando yo era joven, yo miraba la tele de vez en cuando. Open Response 2 part A: Plant cells and fungal cells have many of thesame types of organelles. Structures X and Y are found in both plant cellsand fungal cells. Structure Z is found in plant cells, but not in fungal cells. A- What is party?XZ HELP PLEASE PLEASE PLEASE!!The function f(x) = 4x 8 is reflected across the y-axis, resulting in a new function, g(x). Write the EQUATION of g(x). Please show how you got it!!! are the triangles congruent? if they are, state how they are congruent. Plz help!In order for the parallelogram tobe a rectangle, x = [? ]13x+34910x+10 How will you display the contribution in your museum Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat