helppp me plzzzzzzz i am no god at the maths

Helppp Me Plzzzzzzz I Am No God At The Maths

Answers

Answer 1

Answer:

i beleive its n-6

Step-by-step explanation:

Answer 2
i think n-6 but i’m not sure:(

Related Questions

A movie theatre marks up the price of popcorn 12 3/4 times the original cost. express 12 3/4 as a percent and decimal.

Answers

Answer:

Answer: F. 1,275% and 12.75.

Step-by-step explanation:

Ratios

Ratios are usually expressed as decimals, fractions, colon notation, and percentages.

For example, if the ratio of two quantities is 2, it can be expressed as:

2, 2/1, 2:1, 200%

To obtain the percentage expression, just multiply by 100%.

The price of the popcorn sold at a movie theatre was marked up as 12 3/4 times the original cost.

The mixed fraction can be converted to a decimal by just adding their parts as follows:

12 + 3/4 = 12.75

Now to express it as a percentage, multiply by 100%:

12.75 * 100% = 1,275%

Answer: F. 1,275% and 12.75.

Use the equation p= 8.31/v where p = pressure and V = volume.

What happens to the pressure as the volume approaches 0? Explain your reasoning.

Answers

Answer: pressure increases

Step-by-step explanation:

because Boyle's law states that pressure and volume have an inverse relationship, if we decrease volume the pressure will increase.

Another explanation: since volume approaches 0, we're dividing by a smaller number, and doing this gives us a larger value for pressure

Answer:

The pressure approaches infinity.

The function is undefined for V = 0.

There is an asymptote at V = 0.

Step-by-step explanation:

Exact answers for edge

Identify the polynomial divisor, dividend, and quotient represented by the synthetic division.

Divisor:
A. –3
B. 3
C. x – 3
D. x + 3

Dividend:
A. 2x3 + 11x2 + 18x + 9
B. -6x3 - 15x - 9
C. 2x2 + 5x + 3

Quotient:
A. 2x4 + 11x3 + 18x + 9
B. 2x3 + 5x2 + 3x
C. 2x2 + 5x + 3

Answers

Answer:

Divisor:D

Divedend: A

Quotient:C

Step-by-step explanation:

The divisor = (x+3), the dividend = (2x³+11x²+18x+9) and the quotient = (2x²+5x+3)

What is synthetic division?

Synthetic division is a method for manually performing Euclidean division of polynomials.

Given that polynomial divisor, dividend and quotient ;

The correct divisor, dividend and quotient are (x+3), (2x³+11x²+18x+9) and (2x²+5x+3) respectively

Hence, The divisor = (x+3), the dividend = (2x³+11x²+18x+9) and the quotient = (2x²+5x+3)

For more references on Synthetic division, click;

https://brainly.com/question/28824872

#SPJ2

You buy 6 items for $25.60. About how much did you spend?
$125
$145
$75
$150

Answers

The answer is 150 because 6 times 25.60 equals 153.6

Answer: About $150.

Explanation: Each item cost $25.60, so I multiplied it into six, equalling about $150.

Unghiurile ∢AOB și ∢BOC sunt adiacente suplementare, iar OM, respectiv ON, sunt bisectoarele acestora. Fie BD ⊥ OM, D ∈ OM și BE ⊥ ON, E ∈ ON . Demonstrați că: a) patrulaterul BDOE este dreptunghi. b) OB ≡ DE .

Answers

Answer:

Following are the solution to this question:

Step-by-step explanation:

[tex]\angle AOB + \angle BOC = 180\\\\\angle MON = (\angle AOB + \angle BOC): 2 \\\\[/tex]

            [tex]= 180: 2 \\\\=\frac{180}{2}\\\\= 90^{\circ}[/tex]

In point a:

[tex]\angle AOB = 60\\\\ \angle BOC = 120\\\\ \angle MON = (60 + 120): 2 \\\\[/tex]

            [tex]= 180: 2 \\\\=\frac{180}{2}\\\\= 90^{\circ}[/tex]

In point b:

[tex]\angle BOC = 100\\\\\angle AOB = 80\\\\ \angle MON = (100 + 80): 2[/tex]

            [tex]= 180: 2 \\\\=\frac{180}{2}\\\\= 90^{\circ}[/tex]

Plsss need help jahahahahababahhaha

Answers

Answer:

ummm try to solve it

Step-by-step explanation:

Given: ABC is a right triangle with right angle C. AB= 14 centimeters and mA = 33°
What is AC?
Enter your answer, rounded to the nearest tenth, in the box

Answers

Answer:

AC ≈ 7.6 cm

Step-by-step explanation:

I've attached a drawing of this problem below as a visual aid.

We know that this is a right triangle (one of the angles is 90°), one of the other angles (mA) is 33°, and the hypotenuse (AB) is 14 cm. We need to calculate the length of one of the other sides. We can use sine, cosine, or tangent.

Remember SOHCAHTOA?

→ soh (Sine = Opposite / Hypotenuse)

→ cah (Cosine = Adjacent / Hypotenuse)

→ toa (Tangent = Opposite / Adjacent)

The side we want to calculate happens to be adjacent to the angle mA (33°). So, we use cosine. We put in the values we know and solve for x, the missing side:

→ sin(33°) = [tex]\frac{x}{14}[/tex]

→ x = sin(33°) × 14

→ x ≈ 7.6

The length of AC is 7.6 centimeters.

help pls thank you!!

Answers

10/2.5= 4
2/3*4= 8/3

2 2/3 is your answer (C)

Answer:

C 2+2/3

Step-by-step explanation:

10/2.5= 4

2/3*4= 2+2/3

Anthony read 46 pages of a book in 23 minutes.

To find the unit rate, use
.
Anthony read
pages per minute.

Answers

Answer: Anthony read 2 pages per minute.

Step-by-step explanation:

Answer: 2 pages/ 1 minute or (2 pages per minute)

Step-by-step explanation: To find the unit rate for how many pages of a book Anthony finds in 23 minutes, you’ll have to divide 46 by 23, which gives you a final result of 2 pages/ 1 minute or (2 pages per minute).

In the middle of a very cold winter night the temperature outside is -20'c at nine o'clock in the morning it has become 30 degrees warmer. What is the temperature at nine o'clock

Answers

Answer:

10°c

Step-by-step explanation:

-20°c + 30° = 10°c

Can I get Brainliest? Plz!

LAST ONE I NEED HELP ON PLEASE

Answers

Answer:

A

Step-by-step explanation:

First you find the volume of the cube which is 512. Then you find the volume of the cone which is 133.97333333 and so on. Lastly you subtract 512 by 133.973333333 (and so on) which is 378.026667. Rounded the answer would be 378.0 which is answer A.

Plz mark brainliest!!! I spent lot of time on this.

jason buys 2 baseball bats for $300 what is the unit rate per bat

Answers

Answer:

300/2= $150

Hope this is what you are looking for!

g(x)=f(x-1)-5

Describe the transformation to f(x) that results in g(x).

1

2

f(x) has been

translated to the left

one and down five.

f(x) has been

translated to the

right one and down

five.

f(x) has been

translated to the

right one and up five.

f(x) has been

translated to the left

one and up five.

Answers

Answer:

f(x) has been  translated to the  right one and down  five.

Step-by-step explanation:

Given

[tex]g(x)=f(x-1)-5[/tex]

Required

Determine the transformation

Taking the analysis one at a time

The relationship between f(x) and f(x - h) is that f(x) is translated h units to the right

So, when f(x) becomes f(x-1), it is as a result of f(x) being translated 1 unit to the right

The relationship between f(x) and f(x) - h is that f(x) is translated h units downwards

So, when f(x - 1) becomes f(x - 1) - 5, it is as a result of f(x - 1) being translated 5 units downwards.

Hence, option 2 answers the question

If 10 cm on a map represents 25 km of actual ground, how many centimetres would 45 km of actual ground be on a map?

Answers

Answer:

The answer would be 20cm.

Which is greater than 4: (a) 5 or (b) 5?

Answers

Answer:

I think C. is correct

Step-by-step explanation:

Just trust me, I'm smart ;)

Answer:

they both are the same number

Step-by-step explanation:

Mike is cutting bows out of ribbon which will be used to warp gifts. If mike needs 3 1/2 feet of ribbon to make a bow, and he has 14 feet of ribbon, then how many bows can mike make?

Answers

Answer:

Mike can make 4 bows

Step-by-step explanation:

Given

[tex]1\ bow = 3\frac{1}{2}\ ft[/tex]

[tex]Ribbon = 14\ ft[/tex]

Required

Determine the number of bows he can make

To do this, we simply divide the length of the ribbon by length of 1 bow:

i.e.

[tex]Number = Ribbon/1\ bow[/tex]

[tex]Number = 14\ ft/3\frac{1}{2}\ ft[/tex]

[tex]Number = 14/3\frac{1}{2}[/tex]

[tex]Number = 14/\frac{7}{2}[/tex]

Convert to *

[tex]Number = 14 * \frac{2}{7}[/tex]

[tex]Number = \frac{28}{7}[/tex]

[tex]Number = 4[/tex]

Hence, Mike can make 4 bows

pls help me whats 45x57

Answers

Answer:

2565

Step-by-step explanation:

:)

Answer:

2565

Step-by-step explanation:

In​ 2009, a poll found that ​47% of people favored the protection of the environment at the risk of limiting energy​ supplies, while 47​% favored the development of energy supplies even if that risked harming the environment. Another 4​% felt that energy and the environment were equally important. what's the probability a person had​ "No Opinion"? NEED HELP ASAP!

Answers

Answer:

It will be 84

Step-by-step explanation:

what is the equation of the line through (2,3) and (0, -1)

Answers

so 3x2 equals 6 and 0 x 1 equals 0 so 0x6 equals 0 so its zero

Answer:

0

Step-by-step explanation:

Plzzz help I will mark brainliestttt

Answers

Answer:

Not a function

Step-by-step explanation:

For every input there is one and only one output. So on this graph, it shows that there are two dots on a single vertical line, which means that there are two outputs. Because the definition of a function is "for every input there is one and only one output" we know that it is not a function.

Add a researcher compared the Heights and shoe sizes for 50 men, selected at random. The equation shown describes a line of best fit for the data, where X is the shoe size and why is the height, in inches (y=1.6x + 58)

Answers

Complete question :

a researcher compared the Heights and shoe sizes for 50 men, selected at random. The equation shown describes a line of best fit for the data, where X is the shoe size and y is the height, in inches (y=1.6x + 58)

Based on the equation, what is the approximate shoe size for a man having a height of 60 inches

Answer:

1.25

Step-by-step explanation:

Given the regression equation :

y=1.6x + 58

X = shoe size ; y = height

Using the equation, the approximate shoe size of a man with a height of 60 will be ;

60 = 1.6x + 58

60 - 58 = 1.6x

2 = 1.6x

2/1.6 = 1.6x / 1.6

x = 2 / 1.6

x = 1.25

Hence, approximate shoe size of a man with a height of 60 will be 1.25

WHAT IS THE SLOPE? !! WILL GIVE BRAINLIEST

Answers

Answer:

To find the slope, you divide the difference of the y-coordinates of 2 points on a line by the difference of the x-coordinates of those same 2 points

Answer:

Step-by-step explanation:

2/3 is your slope.

Mother has purchased 75 yards of green fabric and 125 yards of white fabric to make green and white curtains. What is the largest number of curtains she can make if she wants all the curtains to be exactly the same length, and to have no fabric left over? How many yards of each kind of fabric would be used for each curtain?

Answers

Answer:

I don't fing know.

Step-by-step explanation:

Answer:

It would be 125 divided by 75.

One of your friends gives you $10 for a charity walkathon. Another friend gives you an amount per mile. After 5 miles, you have raised $13.50 total. Write an equation in slope-intercept form that represents the amount y of money you have raised after x miles.

y=

Answers

Answer:

y  = 0.70x-  10.00

Step-by-step explanation:

--  Since one friend gave you 10.00 ,subtractthis from the 13.50 to give you the amount earned by walking the 5 miles

--  13.5-10.00  =  $3.50  

--  Since you walked 5 miles, divide by 5 to give you 0.70 per mile earned.

So, an equation that represents the amount of money earned is:  

y  = 0.70x-  10.00  . This is in slope-intercept form; the slope is $0.70 and represents the amount of money earned per mile  and the intercept is $10.00 and represents the initial amount of money that you were given.

a rectangle has a length of x3y4 inches a width of xy7 inches. which expression represents the ratio of the length of the rectangle to the width of the rectangle?

Answers

Answer: R = x^2/y^3

Step-by-step explanation:

here we will use the relation:

x^a/x^b = x^(a - b)

We know that:

Length = x^3*y^4

Width = x*y^7

And we want to find an expression that represents the ratio between the length and the width.

Then we just need to take the quotient Lenght/width or:

R = ( x^3*y^4)/(x*y^7)

Now first let's distribute in such way the x's and the y's are separated, and then let's use the relationship that is above.

= (x^3/x)*(y^4/y^7) = x^(3 - 1)*y^(4 - 7) = x^2*y^-3

R = x^2/y^3

The ratio of the length of the rectangle to the width of the rectangle is  [tex]\frac{x^{2} }{y^{3} }[/tex]

Rectangle:

Given that,

Area of rectangle is multiplication of length and width of rectangle.

length of rectangle [tex]=x^{3} y^{4}[/tex] inches

Width of  rectangle  [tex]=xy^{7}[/tex] inches.

the ratio of the length of the rectangle to the width of the rectangle is,

                 [tex]=\frac{x^{3}y^{4} }{xy^{7} } =\frac{x^{2} }{y^{3} }[/tex]

Learn more about the rectangle here:

https://brainly.com/question/19819849

CAN SOMEONE HELP ME FAST
Find the distance between the two points in simplest radical form.
(-5, 8) (-3, 1)

Answers

Answer:

6.40312423 hope that helps

Answer:

[tex]\sqrt{53}[/tex]

Step-by-step explanation:

Calculate the distance d using the distance formula

d = [tex]\sqrt{(x_{2}-x_{1})^2+(y_{2}-y_{1})^2 }[/tex]

with (x₁, y₁ ) = (- 5, 8) and (x₂, y₂ ) = (- 3, 1)

d = [tex]\sqrt{(-3+5)^2+(1-8)^2}[/tex]

   = [tex]\sqrt{2^2+(-7)^2}[/tex]

   = [tex]\sqrt{4+49}[/tex]

    = [tex]\sqrt{53}[/tex]

A population of values has a normal distribution with μ = 245.3 and σ = 96 . You intend to draw a random sample of size n = 50 . Find the probability that a single randomly selected value is greater than 246.7. P(X > 246.7) = 0.0146 Incorrect Find the probability that a sample of size n = 50 is randomly selected with a mean greater than 246.7. P(M > 246.7) = Enter your answers as numbers accurate to 4 decimal places. Answers obtained using exact z-scores or z-scores rounded to 3 decimal places are accepted.

Answers

Answer:

0.4589

Step-by-step explanation:

We solve using z score formula

The z score formula for a random number of samples is:

z = (x-μ)/σ/√n, where x is the raw score, μ is the population mean, and σ is the population standard deviation

Hence:

z = 246.7 - 245.3/96/√50

z = 0.10312

Probability value from Z-Table:

P(x<246.7) = 0.54107

P(x>246.7) = 1 - P(x<246.7) = 0.45893

Approximately to 4 decimal places = 0.4589

The probability that a single randomly selected value is greater than 246.7 is 0.4589

PLEASE HELP ME LIKE IM GOING TO CRY ILL give you brainliest if the answer is correct and 20/40 points..............Ben participated in a race. During the first half of the race, he walked 3 miles and ran at a rate of 5 miles per hour for x hours. During the second half of the race, he walked for 2 miles and ran at a rate of 5.5 miles per hour for x hours. What equation could you write to solve for the number of hours Ben ran during each half of the race? Let y represent the number of miles in half the race. Write two equations, one for the first half of the race and one for the second half. How could you transform these two equations to be the same as the original equation you wrote to solve for x? What do you think this means about solving for the variables in a situation represented by two equations?

Answers

Answer:

Answer are at the bottom!

Step-by-step explanation:

First equation: y=5x

Second equation: y=5.5x

Unit rate:

x/5.5

5.5/5.5

x/1

Hope this helps!

1 Which expression is equivalent to (7x – 5) – (3x - 2)?​

Answers

Answer:

The answer is D.

Step-by-step explanation:

Choose the value of x for f(x)= x^2-3x when f(x) = 10.

Answers

Answer:

f(10)=70

Step-by-step explanation:

[tex]f(x)=x^{2} -3x\\f(10)=10^{2} -3(10)\\f(10)=100-30=70[/tex]

Other Questions
Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists? About 1/5 of all adults in the United States have type O blood. If four randomly selected adults donate blood, find the probability of each of the following events. a. All four are type O. b. None of them is type O. c. Two out of the four are type O . Whats the answer for this question guys??? a copper ore contains 3.00% of copper carbonate, CuCO3, by mass. Which mass of copper would be obtained from 1 tonne of the ore? A 1.91kg B 3.71kg C 15.3kg D 58.4kg If you travel 7.5 km and walk for 1.5 h, what is your average speed? Show your work? what is the role of private security within the criminal justice system How does the U.S. Constitution best reflect the ideal of separation of powers? Giving brainliest In the equation 3x+7=15, the number 7 is a. At Summer camp, campers are divided into groups. Each group has 16 campers and 2 cabins. How many cabins are needed are needed for 48 campers? A: 14 B: 20 C: 6 D: 30