I only need help with problem number 2.

The name of the clouds with respect to its image are given below:

Clouds may be defined as an observable mass of particles of crystallized vapor suspended in the atmosphere of a planet or moon.

The major function of the clouds is to prevent yourself from the sun's intense heat during the day while to limiting the extremely cold at night.

Therefore, it is well described above.

To learn more about Clouds, refer to the link:

https://brainly.com/question/1783904

#SPJ2

Answer:

DNA is the primary genetic material contained within your cells and in nearly all organisms. It's used to create proteins during protein synthesis, which is a multi-step process that takes the coded message of DNA and converts it into a usable protein molecule.

Explanation:

Answer:

Translation: GAUGCUUCCAACGACCACTA

Transcription:

GTACGAAGGTTGCTGGTGAT

GATGCTTCCAACGACCACTA

Explanation:

Answer: As a result of more people being vaccinated the spread of the infection slowed down.

Because it increases the genetic variability, offering more combinations of genotypes.

Answer:

G1 phase

Explanation:

The cell cycle is divided into 2 major phases

1. The interphase

2. The m phase

The interphase, in chronological order, is further subdivided into

Cells grow and develop at the G1 phase while the G2 phase is characterized by protein synthesis in addition to continued growth.

The DNA of a cell in interphase is doubled at the S phase. This means that if a cell has a 2N amount of DNA at the beginning of the S phase, the amount of DNA at the end would have become 4N. This amount of DNA is shared into 2 daughter cells in equal amounts during mitosis or the m phase, meaning that each daughter cell would have a 2N amount of DNA before entering the interphase.

Hence, cells will have 2N DNA content in a period that spans through the end of the m phase of the cell cycle to the beginning of the S phase of the same cycle. This means that cells at the G1 phase would be the ones with 2N DNA contents.

Cell grows and prepare itself for replication in the G1 phase cell cycle. In G1 phase of cell cycle, cell is in 2n state.

Cell Cycle:

Cell cycle is the life cycle of the cell in which cell grow and divide. This completes in 2 phases,

Interphase:

Cell grows in this phase and prepare to divide. This includes 3 phases,

M- phase:

Therefore, in G1 phase of cell cycle, cell is in 2n state.

To know more about the cell cycle, refer to the link:

https://brainly.com/question/11009129

Answer:

The animals don't know outside of that habit because that where they were born. If they were to be released they would die because they are not used to having to fend for themselves.

Explanation:

Answer: When organisms use organic matter for cellular respiration, ALL the goes back into carbon dioxide, water, and minerals, while ALL the energy leaves the ecosystem as heat. So matter cycles, energy flows through ecosystems. So It is C

Explanation: A. The producers generate food for themselves and others; consumers do not produce anything, instead eating producers, other consumers or both.

B. Autotrophs make food for their own use, but they make enough to support other life as well.Heterotrophs cannot make their own food, so they must eat or absorb it.

So C is correct

Matter and energy always flow from the in ecosystems from autotrophs to the consumer.

The energy flow in the ecosystem is one of the important factors that enables the survival of such a huge number of animals. An ecosystem is made up of a network of connections between living and non-living elements.

All of the energy needed by living things is provided by the sun. About 1% of all radiant energy is absorbed by green plants and distributed throughout the ecosystem.

According to the first law of thermodynamics, energy cannot be generated or destroyed. The energy source, in this case solar energy, cannot be created or destroyed. It can only be moved from one system to another, just like a form is moved from one form to another.

Therefore, Matter and energy always flow from the in ecosystems from autotrophs to the consumer.

To learn more about energy, refer to the link:

https://brainly.com/question/1932868

#SPJ2

Answer:

None of the birds have the same niche.

Explanation:

They all have different niches because of the food they ate. Over time, they were gentically changing to adapt to their own food.

Answer: Glucose

Explanation: Photosynthesis is a set of chemical reactions that uses energy from the sun and carbon dioxide to produce sugar and oxygen. The sugar provides plants with energy to grow.

Answer:

No, because cell division is expected to decrease not only the net amount of cyclin molecules in daughter cells but also the volume of these daughter cells compared to the original parent cell, and therefore the concentration should be nearly equal.

Explanation:

When a cell divides to produce two daughter cells, the cell components including its previously duplicated genetic material (DNA), organelles, signaling molecules, fatty acids (lipids), proteins, etc., are distributed into daughter cells. These daughter cells have a smaller volume compared to the original parent cell. In consequence, the concentration of cellular components (including cyclin proteins) should be similar between parent cell and daughter cells.

Answer:

The rabbits have different versions of the gene for ear shape, which instruct for different proteins that make differently shaped ears. A Father sheep has curly wool while a Mother sheep has straight wool.

Explanation:

I majored in Biology

Answer:

Explanation: Each rabbit has a different ear shape because they have different versions of the gene for ear shape that connect together to make different ear shapes. - D

Answer:

This is because when the wolves preyed on the deer, their population got regulated. Due to this, the competition for resources amongst the surviving deer population got reduced resulting in low starvation.

This is because the deer's numbers were controlled when wolves preyed on them. As a result, there was less rivalry for resources among the remaining deer population, which led to decreased hunger.

"Predation" and "starvation" are both ecological concepts related to the interactions and dynamics of populations within ecosystems.

Predation is a biological interaction in which one organism, called the predator, hunts, captures, kills, and consumes another organism, known as the prey. Predation is a common relationship in nature, observed across various taxa, such as carnivores hunting herbivores or parasites feeding on host organisms.

Starvation refers to the condition in which an organism suffers from a lack of sufficient food or nutrients required for its survival and normal functioning. When resources become scarce or unavailable, individuals within a population may not obtain enough food to sustain themselves.

Therefore, there was less rivalry for resources among the remaining deer population, which led to decreased hunger.

For more details regarding "Predation" and "starvation", visit:

https://brainly.com/question/17407899

#SPJ6

Hardness is a measure of how resistant solid matter is to various kinds of permanent shape change when a force is applied Macroscopic hardness is generally characterized by strong intermolecular bonds, but the behavior of solid materials under force is complex; therefore, there are different measurements of hardness: scratch hardness, indentation hardness, and rebound hardness. Hardness is dependent on ductility, elastic stiffness, plasticity, strain, strength, toughness, viscoelasticity, and viscosity. Common examples of hard matter are ceramics, concrete, certain metals, and super hard materials, which can be contrasted with soft matter.

Answer:

The correct answer is Option B (Carrying out research). The step that follows this step involves forming B.a conclusion

Explanation:

The Natural environment  around us is a function of both the living things and the non-living things. So, environmental science is the study of the natural environment around us. This study includes how to tackle environmental problems and further study on how humans could be impacted by the interactions with their environment. The scientific method is a step taken towards ensuring development in a field by bringing new discoveries and challenging existing beliefs through scientific tests and research. Generally, for most scientific methods of many fields, it starts with:

1. Observations

2. Making inquiry which involves asking questions

3. Forming a hypothesis, which means making untested assumptions

4. Conducting an experiment to check the hypothesis

5. Analyze the results

6. Publish the results

The correct answer is Option B (Carrying out research). Because it involves the scientific method highlighted above. The step that follows this step involves forming B.a conclusion

In polar regions vapor deposition is the primary method of crystal growth in the upper fairing

Explanation:

hope this helps have a nice day :) ♡

Answer : contamination in crops results mainly from a reduction in marketable volume

Aflatoxin consumed contributes to the mutagenic , carcinogenic , teratogenic , and immunosuppressive health effects in humans.

Answer:

Second-level Consumers - consumers that get their energy from first-level consumers and/or producers. Carnivores - organisms that eat only other animals. Third-level Consumers - consumers that eat second-level consumers and/or first-level consumers.

Answer:

Reginald Punnet discovered patterns of inheritance during pea plant experiments

Explanation:

is there more than one right answer

Answer:

plastic consumption is like using a lot of plastic and plastic waste is when you throw out a lot.

Explanation:

consumption means like eating /using

waste means throwing out / not really using

hope this helped. btw I'm not sure if this is right but I hope it is!

Answer:

Explanation:

Daughter cells are produced after a single cell undergoes cell division. During mitosis, one pair of daughter cells is created after one round of DNA replication. In mitosis, a single cell becomes two identical cells. ... Daughter cells in this sense are actually closer to clones

Answer:

true

Explanation:

Explanation:

retina

photoreceptor; rod and cone

Rods and cones are photoreceptive cells located in the retina of the eye.

Answer:

The answer would be D because, stars have nothing to do with the water cycle.

answer:

the stars appearing to move through the night sky.

- so option D.

Answer:

AGAINST for sure

Explanation:

ive personally raised GMO animals and they have no life. like chickens at the age of 8 weeks the breasts on GMO chickens are so large they are unable to walk and if u do not butcher them they will have heart attacks at around 9 weeks. they also dont get to go outside and walk around bc that makes them lose weight. so most of the GMO chickens do not get to go outside and actually have clean air. let alone see the sun light and stand in grass.

Answer:

A. true

Explanation:

i mean if you have empathy then yeah it's true

Answer:

A

Explanation:

It means you have the ability to feel what someone is experiencing.