What class is the sting ray in?

Answers

Answer 1

Answer:

Cartilaginous fishes

Explanation:

Answer 2

Answer:

math lol what he said so yah


Related Questions

Which statement below does NOT correctly describe water's chemical
properties?

a. Water is a neutral substance - it is neither a base or acid

b. Water is an inert substance

c. Water is not flammable or combustible

d. Water is reactive and catalyzes many reactions that take place inside living things

Answers

Answer:

b.

Explanation:

This is incorrect, because, "water is a powerful accelerator of chemical reactions."

Credit to www.astronno.com

human rights violated when George Floyd was apprehended​

Answers

Answer:

tell me how to answer it

This is correct . True

Blood has a lower concentration of hydrogen ions than cellular cytoplasm. What does that tell us about the pH?

Answers

Answer:Acids and bases In the human body, both blood and the cytosol (watery goo) inside of cells have pH values close to neutral. ... A base, in contrast, raises pH by providing hydroxide (OH −start superscript, minus, end superscript) or another ion or molecule that scoops up hydrogen ions and removes them from solution.

Explanation:

Two amino acids unite by forming a(n) bond between them and releasing a molecule of . The union of many amino acids forms a macromolecule called a .

Answers

Answer:

Protein/nucleic acid/Carbohydrates/lipid

The correct and most appropriate words to fill in the blanks are: peptide, water and protein.

An amino acid can be defined as a simple organic chemical compound that is made up of an acidic carboxyl group (COOH), a basic amino group ([tex]NH_2[/tex]), and a variable (unique) side chain group.

Generally, an amino acid is typically named after two (2) of its functional groups and these are:

An acidic carboxyl group (COOH): it acts like an acid.A basic amino group ([tex]NH_2[/tex]): it acts like a base.

Basically, a peptide bond is formed between two amino acids when they unite. Also, this chemical reaction lead to the release of a molecule of water.

Finally, the union of many amino acids forms a macromolecule called a protein.

In conclusion, protein is a macromolecule which is formed as a result of the union of many amino acids.

Read more: https://brainly.com/question/14681125

A 10.0 cm3 sample of copper has a mass of 89.6 g. What is the density of copper?

Answers

Answer:

[tex]\boxed {\boxed {\sf d=8.96 \ g/cm^3}}[/tex]

Explanation:

Density can be found by dividing the mass by the volume.

[tex]d=\frac{m}{v}[/tex]

The mass of the copper is 89.6 grams.

The volume is 10 cubic centimeters.

[tex]m=89.6 \ g\\v= 10 \ cm^3[/tex]

Substitute the values into the formula.

[tex]d=\frac{89.6 \ g }{10 \ cm^3}[/tex]

Divide.

[tex]d=8.96 \ g/cm^3[/tex]

The density of copper is 8.96 grams per cubic centimeter.

if 28% of the bases in a DNA strand are guanine, what percentage are thymine

Answers

Answer:

22%

Explanation:

According to Erwin Chargaff in his complementary base pairing rule, a DNA molecule consists of four nucleotide bases that pair with one another in the follow order: Adenine (A) to Thymine (T), and Guanine (G) to Cytosine (C).

According to Chargaff, the amount of Adenine in the DNA equals the amount of Thymine while the amount of Guanine in the DNA equals the amount of Cytosine. The sum of all the bases equals 100%. That is;

A + T + G + C = 100%

In this question, if 28% of the bases in a DNA strand are Guanine, the amount of Cytosine will also be 28%. Hence,

28% + 28% + A + T = 100

56% + A + T = 100

A + T = 100% - 56%

A + T = 44%

Since, A = T

A/T = 44/2

A/T = 22%

Hence, the amount of Thymine in the DNA strand will be 22%

Which of the following is NOT a stage of the Cell Cycle (somatic cells)?
1. Cytokinesis
2. Meiosis
3. Interphase
4. Mitosis

Answers

Answer:

Meiosis

Explanation:

Only reproductive cells/gametes use meiosis.

HELP ME POR FAVOR WILL GIVE BRAINLIEST AND YOU GET 25 POINTS, WHAT A STEALLLL.. ok

Which sequence best explains the relationship between DNA and protein structure and function?


DNA → gene → protein → trait

DNA → amino acid triplets → protein → trait

DNA base triplets → amino acid sequence → protein folding pattern → protein shape and function

DNA shape → amino acid sequence → protein shape and function

ty <33

Answers

Answer:

DNA base triplets → amino acid sequence → protein folding pattern → protein shape and function

Explanation:

From Google:

"The Rules of Protein Structure. The function of a protein is determined by its shape. The shape of a protein is determined by its primary structure (sequence of amino acids). The sequence of amino acids in a protein is determined by the sequence of nucleotides [base triplet] in the gene (DNA) encoding it."

Graves’ Disease is an autoimmune disorder that causes an overproduction of the hormone produced in the thyroid. These hormones are responsible for cellular metabolism. What would this disorder probably result in?

Answers

Answer:

Explanation:

Graves' disease is an autoimmune disorder in which antibodies produced by your immune system stimulate your thyroid to produce too much T4. It's the most common cause of hyperthyroidism. Hyperfunctioning thyroid nodules (toxic adenoma, toxic multinodular goiter or Plummer's disease).

What is the lock and key theory of enzyme-substrate binding?

Answers

Answer:

Quick Reference. A theory to explain the mechanism of enzymatic reactions, in which it is proposed that the enzyme and substrate(s) bind temporarily to form an enzyme–substrate complex. The binding site on the enzyme is known as the 'active site' and is structurally complementary to the substrate(s).

What property is being shown in the picture below?
a. capillary action
b. adhesion
c. cohesion
d. all of the above

And explain why.

Answers

Answer:

C. Cohesion

Explanation:

The paper clip is using the “surface tension” to float!

i need help
i need ideas. Basically, you Create a story to teach class of 2024 and 2025 how to be good students. but its an Extra Credit Opportunity - Student Fable assignment.
i cant think of any ideas

Answers

Let me help you here :)

Start by presenting yourself, your name, where you from, etc. Then you can explain why is it important to complete all your assignments and study to get good grades... You can also talk about how High School will reflect in your future and applications for colleges. In your story write how important is to always pay attention in class and listen to your teacher.
Hope this helps!!

When experiencing oxygen debt, why do human cells not carry out the process of alcoholic fermentation?

Answers

I believe the answer is because oxygen is a fuel/input/reactant to alcoholic fermentation.

Christopher Columbus used the presence of suspended seaweed in the ocean to
determine how far away he was from the coast of the Africa. Seaweed, or kelp, is
placed under the Protista kingătom. What type of protist did Columbus see?
a)protozoa
b) slime mold
c) water mold
d) brown algae

Answers

Your answer is d he saw brown algae

Brown algae is the type of protist Columbus saw. Therefore, option (D) is correct.

What are brown algae?

Seaweed is a type of brown algae, which is a type of protist that belongs to the kingdom Protista. Brown algae are large, multicellular algae that grow in the ocean and are often found in shallow, warm waters. They have a complex structure and are made up of many cells that are organized into tissues and organs. Brown algae are photosynthetic, meaning they use sunlight to produce energy and nutrients, and they are an important source of food and habitat for many marine organisms.

Other types of protists include protozoa, which are single-celled, heterotrophic organisms that can move using cilia, flagella, or pseudopodia; slime molds, which are fungi-like organisms that can move and are often found in moist environments; and water molds, which are fungi-like organisms that can grow in water and can cause disease in plants and animals.

Learn more about brown algae, here:

https://brainly.com/question/8717436

#SPJ2

differences between reproduction in mammals and amphibians.​

Answers

Answer:

the answer is a little weird but hope this helps

Explanation:

While all of these animals reproduce sexually (meaning that the species consists of males and females and mating involves the fetilization of eggs by sperm), reptiles and mammals reproduce through internal fertilization (inside the female) whereas amphibians practice external fertilization.

Answer:

While all of these animals reproduce sexually (meaning that the species consists of males and females and mating involves the fetilization of eggs by sperm), reptiles and mammals reproduce through internal fertilization (inside the female) whereas amphibians practice external fertilization

A line passes through the points( -3,-4) and (6,2)

Answers

What are you asking? Slope? If so. You would do change in y over change in x. So subtract 2 and -4 to get positive 6, then subtract 6 and -3 to get positive 9. Your slope is either 1/3 if it’s increasing, or negative 1/3 if it’s decreasing.

Answer:

y = ⅔x - 2

Explanation:

We can solve for a linear equation of a line that passes through these two points by the elimination method and then substitute.

We simply write these two points in the form y = mx + c, where m is the gradient and c is the y-intercept (offset). So:

-4 = -3m + c

2 = 6m + c

____________ -

We can first eliminate c to solve for m and then substitute m back into either equation to solve for c. (See attached image for solving steps)

Then, we get:

m = ⅔

c = -2

so y = ⅔x - 2

Can someone help me with this question please?

Answers

Answer:

B

Explanation:

They use echolocation (sound waves) because they cannot see the bottom of the ocean.

Good luck!

Which of the following is the most important reason to maintain a high level of cardiovascular health?
A. A higher level of fitness makes it easier to develop larger muscles.
B. A higher level of fitness makes you more attractive to other people.
C. A higher level of fitness allows you to live a longer, healthier life.
D. A higher level of fitness improves your IQ.

Answers

Answer:

C

Explanation:

I think because the more healthier you are, the longer you'll live

How do structures in organisms compare with structures of non-living things such has construction cranes, buildings, ships, airplanes, or bridges?

Answers

They all are able to break down

Explain how one celled organisms get oxygen in water.

Answers

Answer:

n unicellular organisms, oxygen diffuses across the cell membrane into the cell. Carbon dioxide diffuses out of the cell once the concentration of carbon dioxide is higher inside the cell than it is outside of the cell. Some micro-organisms, including some bacteria and fungi, can survive without oxygen.

Explanation:

EASY 7TH GRADE SCIENCE FIRST PERSON MARKED BRAINLIEST!!!!

Which information does a student need to differentiate between the speed and the velocity of a vehicle in motion

A. The rate of the motion
B. The direction of the motion
C. The change in the amount of motion
D. The amount of distance traveled during motion

Answers

Answer: The action from a force can cause an object to move or can speed up accelerate, to slow down (decelerate), to stop, or to change direction. Since any change in velocity is considered acceleration, it could be said that a force on an object results in the acceleration of a object.

Explanation:

Answer:

(B) The direction of the motion

Explanation:

Which example has the most kinetic energy a football resting on a kicking tee a hurt football player sitting on the bench a football flying through a goal post a penalty flag on the ground

Answers

Answer:

The football flying through the goal

Explanation:

Kinetic energy is basiaclly moving energy. Since only the football going through the goal is moving, that's the one with the most kinetic energy.  

HELP ASAP EMERGENCY NEED NOW BRAINLIEST 100 POINTS!



A diagram showing two plates colliding, with one plate moving below the other. What type of plate boundary is illustrated in the image? What is the movement of one plate below another called?

Answers

Answer:

Hello There!! :D

Explanation:

Your answers are:

1. Convergent

2. Subduction

Hope this helps you!! ♥️♥️♥

- abakugosimp

Answer:

A. Convergent

B. Subduction

Explanation:

What type of plate boundary is illustrated in the image?

convergent

What is the movement of one plate below another called?

subduction

_______ is where both organisms gain from the interaction. A. Commensalism B. Mutualism C. Predation​

Answers

Answer:

B. Mutualism

Explanation:

Mutual means both parties feel the same way, so they both gain from the interaction. I just looked at the root of the word

Answer:

b . mutualism

Explanation: MUTUALISM IS A FORM  OF SYMBIOSIS  WHEREBY BOTH ORGANISMS INVOLVED BENEFIT FROM THE RELATIONSHIP

Spongy tissue is best described as dense smooth and homogenous
True or false

Answers

false, it’s compact

Open Response 2 part A: Plant cells and fungal cells have many of the
same types of organelles. Structures X and Y are found in both plant cells
and fungal cells. Structure Z is found in plant cells, but not in fungal cells. A
- What is party?
X
Z

Answers

The answer will be z because u can dance and take the L on black kids

Which is an environmental factor that would MOST LIKELY have an adverse impact on the stability of an ecosystem?

Answers

It is desserts and oceans because the water helps

The climate change would most likely exhibit an adverse influence on the stability of an ecosystem.

Climate change impacts on ecosystems:

Climate change influences ecosystems in numerous ways. Warming may make the species to migrate to higher elevations or latitudes where temperatures are more favorable.

Climate change is resulting in the elevation of sea level, resulting in intrusion of seawater into the freshwater system, which is forcing the key species to relocate. Thus, removing the prey or predators, which are essential for the stability of the ecosystem.

Due to climate change, the vegetative biomes in the United States is predicted to change across 5 to 20 percent by 2100. A specific species due to climate change ca ripple through a food web and influence a broad array of other species, thus, disrupting the food web.

Change in climate and shift in ecological conditions could support the spread of parasites, pathogens, and diseases with potentially adverse influences on agriculture, human health, and fisheries. Climate change, along with pollution and habitat destruction is one of the stressors, which can result in the extinction of species.

Thus, climate change is the environmental factor, which would most likely exhibit an adverse influence on the stability of the ecosystem.

Find out more information about the impact of climate change on the ecosystems here:

https://brainly.com/question/11607190

HELP ASAP EMERGENCY NEED NOW BRAINLIEST 100 POINTS!
A diagram showing two plates colliding, with one plate moving below the other. What type of plate boundary is illustrated in the image? What is the movement of one plate below another called?

Answers

Answer:

Convergent

Subduction

Explanation:

Answer:

B. convergent

C. subduction

Explanation:

HELP!!! MAJOR GRADE!!!!!

Gregor Mendel conducted thousands of genetic experiments using pea plants. Mendel is called the Father of Genetics because it was these studies that lead to the principles of genetics. In one of his many experiments, he crossed purple-flowered pea plants with white-flowered pea plants. Much to his surprise, all of the offspring turned out to be peas with purple flowers in appearance.

Although Mendel used the term factors instead of genes, how did Mendel explain why all the pea plants had purple flowers and not a mixture of white and purple flowers?

A.The offspring received the factors (genes) from both parents, but the genotype for purple flowers dominated over white flower pea plants.

B.The offspring only received the factors (genes) from the parent with the genotype for purple flowers and nothing from the white flower parent.

C.The offspring received the factors (genes) from both parents, but the phenotype for purple flowers dominated over the factor for white flowers.

D. The offspring only received the factors (genes) from the parent with the phenotype for purple flowers and nothing from the white flower parent.

Answers

Answer:

A

Explanation:

The purple gene was dominant, so though the plants got "factors" from both parents, only the purple gene was expressed in their phenotype (purple petals).

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Answers

Answer:

u want step by step?

Explanation:

Other Questions
Find tan-1 1.4281 to the nearest degree.a. 10b. 55C. 5d. 35 1. Adding decimals is very similar to adding___________.2.Line up the number vertically so that all the decimal points are_______.3. Add extra______to the right of the number so that each number has the same number of digits to the right of the decimal point.4. Place the______________of the result in line with the other decimal points. The police chief mentions that unionized emergency personnel had already been deployed, so pulling them back would not be worth it. However, there may be long term savings in pulling them back. If the police chief is looking solely at short-term costs and benefits, what type of decision-making bias would this represent? a) discounting the future b) traming effects c) illusion of control d) representativeness Who ever gets this question right is BRAINLIEST. Answer For 15 Points What is the remainder when 3x27x+5 is divided by x+5? A neon sign blinks every 6 minutes, and another sign blinks every 8 minutes. How often do they blink at the same time?A.Every 14 minutesb.Every 24 minutesc.Every 48 minutesd.Every 2 minutes A line passes through the points( -3,-4) and (6,2) A gas occupies a volume of 0.444 L at 0.00C and79.00 kPa. What is the final Kelvin temperature whenthe volume of the gas is changed to 1880. mL and thepressure is changed to 38.70 kPa?Include unit of measurement and use propersignificant figures. The expected return of Stock A is 7%, Stock B is 10% and Stock C is 12%. If you equally invest in these three stocks, what is the expected return of your three-stock portfolio? SOMEONE HELP ME PLS Determine which situation could be represented by the system of linear equations given below. 5x+3y=210 x+y=60A. A candy story sells boxes of chocolates for $5 each and boxes of caramels for $3 each. In one afternoon, the store sold 210 boxes of candy and made a profit of $60.B. An art teacher bought paintbrushes in packs of 5 and packs of 3. She bought a total of 60 packs and now has 210 paintbrushes.C. A guitar requires 5 strings and a banjo requires 3 strings. An orchestra has a total of 210 strings. One guitar player and one banjo player have 60 strings.D. An audience contains 210 people. Student tickets cost $3 each and adult tickets cost $5 each. At one performance, there are 60 more adults than students. A diver is on a board 1.80 m abovethe water. She jumps straight upat 3.62 m/s.At what speed does she hit the water?[?] m/s Write a character sketch for your protagonist in your Module One short story. Include literal, interpretive, and evaluative information. Your character sketch should be 35 complete sentences and include at least three specific details from the text to support your character analysis. (My story is Rules of the game by Amy tan.) A 3-pound bag of carrots costs $11.52. What is the price per ounce? Brian bought a jacket that cost d dollars. He paid the clerk $60,00 He received $7.39in change. How much did Brian pay for the jacket? Name a ray with an endpoint of A. Justify Solution Paths of Linear Equations3(x2)+5x=26 (What property is this?)3x6+5x=26 (What property is this?)8x6=26 (What property is this?)8x=32(What property is this?)x=4 (What property is this?)Here are a list of the properties-Subtraction Property of EqualityAddition Property of EqualityMultiplication Property of EqualityDivision Property of EqualityCombine Like TermsDistributive PropertyGiven Equation What value of y makes the following equation true?12(5y+4)=2+12y This sentence is complex: The air was so polluted that I found it hard to breathe.Please select the best answer from the choices providedTF What determines the amount of thermal energy of an object?