What does the word noteworthy mean as it is used in this sentence? “Her appointment to the Supreme Court by President Ronald Reagan in 1981 was a noteworthy step forward for women.” (paragraph 3)

Answers

Answer 1

Answer:

Significant.

Explanation:

Noteworthy: interesting, significant, or unsual.

In this sentence, 'noteworthy' means significant, because during Reagan's time women were just starting to be seen and accepted in the political view, which was a significant change in society.


Related Questions

Task 7 Decide what the relationship is between the first two we
Then complete the analogy with one of the words in parentheson
Example wrong right
Answer: wrong nght
day fly.eart
sky
sky earth
1 begin end
oper
2 detective inspector teacher
3 incognito disguised foolish
4 insect mosquito dog
5 nose face elbow
6 intelligence stupidity beautiful
pretty)
7 bird parrot vermin
8 tires ambulance knob
9 clue hint cup
10 boy girl day
(reach unlock close)
(professor student child
(smart funny senseless
(cat, bone, colile)
(arm, wrist, knee)
(glamorous, ugly
(poison, animal, mouse)
(hom door, typewriter)
(mug. saucer, drink)
(sun, night, star)​

Answers

Answer:

Decide what the relationship is between the first two we

Then complete the analogy with one of the words in parenthesis

1 begin end close

2 detective inspector

3 incognito disguised

4 insect mosquito animal

5 nose face

6 intelligence stupidity smart

7 bird parrot

8 tires ambulance

9 clue hint

10 boy girl child

What is Juliet conflicted about in Act 3 Scene 2

Answers

Answer:

Juliet feels conflicted because her love for Romeo clashes with her love and sense of duty to Tybalt, her cousin. .

Explanation:

“tragedy is a tool for the living to gain wisdom, not a guide by which to live” what was Robert Kennedy trying to convince his audience to do/think with this appeal?

Answers

Answer:

I THINK THAT HE IS TELLING THE TRUTH

Explanation:

The Chorus
O speaks as a unified voice and often contradicts the values of the audience
contains many individual voices that often contradict each other
O speaks as a unified voice and often reflects the values of the audience
O contains many individual voices and often reflects the values of the audience

help pls bruh. also it’s from oedipus the king for reference

Answers

Answer:

contains many individual voices and often reflects the values of the audience

Please I need help, is basic english. the answers go in the spaces where the numbers are.​

Answers

Answer: I think that is multiple choice

Answer:

19.) A & D, 20.) E - C - D & A

Explanation:

identify the following sentences as simple compound or complex sentence 1 :Mr. Brown's employees finished and submitted their tasks. sentence 2: I called my cousin after she had made the accident. sentence 3: Maria put on her makeup, and then she put on her dress. sentence 4: ai went to the party although I had a headache. please answer mee Because I have an exam tomorrow​

Answers

Answer:

Mr. Brown's employees finished and submitted their tasks.    (simple)

I called my cousin after she had made the accident.    (complex)

Maria put on her makeup, and then she put on her dress.     (compound)

I went to the party although I had a headache.    (complex)

Explanation:

Why is Percy anxious

Answers

If Percy, from Percy Jackson, is anxious, its most likely because he is probably saving the world from corrupt gods.

At this specific moment though, he could just be confused on a test so he came to brainly to ask you and me why he is anxious. He is looking for advice!

Its ok Percy, you got this!

HELP me please I'll give brainlyist to the first person who answer right.

Answers

bruh wrong subject hahah

what is state and it advantages​

Answers

Answer:

State is defined as a territory with its government and borders within a larger country . eg:california

PART B: Which Two phrases from the text best support your answer to Part A

Answers

Answer:

i need the text  

Explanation:

am i the only one online plzz answer
my question is what are the middle east countries

Answers

Answer:

The Middle East is a transcontinental region in Afro-Eurasia which generally includes Western Asia, all of Egypt, and Turkey. The term has come into wider usage as a replacement of the term Near East beginning in the early 20th century.

Answer:

Please see below.

Explanation:

The Middle East is a Afro-Eurasian region that consists of 18 total countries.

These countries are:

Bahrain

Cyprus

Egypt

Iran

Iraq

Israel

Jordan

Kuwait

Lebanon

Oman

Palestine

Qatar

Saudi Arabia

the Syrian Arab Republic

Turkey

the United Arab Emirates

Yemen

Sometimes, the definition of the Middle East can be stretched to include the concept of the 'Greater Middle East.' Please notify me if you'd like me to list those countries as well.

I hope this helps you :)

List all the nouns
Women and men worked together to clear the land plant crops and build homes

Answers

Answer:

women, men, land, crops, homes

Explanation:

women: person

men: person

land: thing

crops: thing

homes: place

A noun is a person, place or thing. Plant is being used as a verb (action) in this sentence so it does not count as a noun.

Select the noun clause in each sentence
Whatever you do make sure you're home on time.
Janice couldn't decide what she should major in at college

Answers

Answer:

Noun clauses are dependent clauses acting as nouns. They begin with words such as how, that, what, who, whoever, whom, where, when, whether, which, whichever and why.  What is more, they can act as subjects, direct objects, indirect objects, predicative nominatives or as objects of prepositions.

Taking all this into account, the noun clauses found in the sentences presented are the following ones: "whatever you do" and "what she should major in at college".  In both cases, the noun clauses in question are actings as the subjects of the sentences.

Answer:

whatever you do

what she should major in college

Explanation:

2 points
6. What literary element is used in the following quote from "The Tell-Tale
Heart"? "...a low dull quick sound, such as a watch makes when enveloped
in cotton."

Answers

Answer:

Imagery

Explanation:

Imagery is a powerful tool used by many writers. It refers to the use of figurative and metaphorical language to create images in the mind of the reader through their senses.

Edgar Allan Poe does this in his short story The Tell-Tale Heart, as well. He describes a sound as low, dull, and quick, like the one a watch wrapped up in cotton makes. We can imagine what that sound is like, which makes us feel like we are a part of the story.

I need someone answer this question for me and if you do answer and it's right you'll be rewarded with 20 points.

Answers

"Full of conflict" is the correct answer

Read the passage.
I was leaning against the high stone wall that ran around the schoolyard. I
was looking up at a white cloud skittering across the sky when all at once
someone tramped down hard on my right foot. Ian Forbes. Snarling bulldog
face. Heel grinding down on my toes. Head thrust forward the way an
animal might before it strikes.
"You wouldn't sing it. So say it," he ordered. "Let me hear you say it."
I tried to pull my foot away but he only ground down harder.
"Say what?" I was telling my face please not to show what my foot felt.
"God save the king. Say it. Those four words. I want to hear you say it."
"I'll never say it." I whispered.
What does this schoolyard encounter repeal about both characters?
Neither feels at home in China.
They miss their homeland.
They are deeply patriotic.
lan is a bully who frightens Jean.

Answers

Answer:

They are deeply patriotic is ur answer!

k-12 ela test.

The thing which this schoolyard encounter repeals about both characters is that C. They are deeply patriotic'

What is Narration?

This refers to the storytelling that is made by a narrator to give the details of a story for better understanding.

Hence, we can see that from the given text, there is the narration of how the schoolyard setting shows the characterization of the characters as it shows that they are deeply patriotic.

Read more about narration here:

https://brainly.com/question/1934766

#SPJ5

(4)Write a story that clearly illustrates the saying: Do not count your chickens before they are hatched.

Answers

Answer:I probably know that chickens come from eggs. A female chicken or hen lays eggs and then they hatch into chicks. Well, not all of them. Some eggs do not have a baby bird.

So, at our farm, a hen produces 15 eggs. If the farmer counts the eggs, she might expect to have 15 chicks once the eggs are hatched. But then five of those eggs do not hatch. Her expectations were not met, so she feels disappointed. She tells her friend how sad she feels. The friend may say to her, “Well, don’t count your chicken before they hatch.

Another way of saying this proverb is: “Don’t count your chickens until they are hatched.”

So, this proverb means you should not depend on something that has yet to happen. It is unwise to make plans based on something that hasn’t happened. Another meaning of this proverb is this: Do not assume to have everything you want until you actually have it in your hands.

Now, let’s talk about the folklore part of our explanation.

“Don’t count your chickens until they are hatched” is a very old saying. Language experts say it appears in different forms and in many different cultures. It is also used in Aesop's Fables, a collection of stories from between 1,300 and 1,400 years ago.

The fable we are talking about is known as “The Milkmaid and Her Pail.” A long time ago, a young woman carried a bucket of milk on her head. As she walked, the milkmaid dreamed of a better life. She wanted to be rich. So, she thought she could sell her milk and then use the money to buy chickens. With chickens she could sell eggs and earn more money!

Explanation:

How many plays did Shakespeare write? 57 152 37 15

Answers

Answer:

37

Explanation:

please give branliest

What is Esperanza's opinion of the Vargas family?

Answers

Answer:

Esperanza describes the Vargas kids, whom she described earlier as being bad. They have a single mother, Rosa Vargas, who is overwhelmed by and unable to control her many children, and who is still sad about the fact that their father left her without a note or any money to help.

Explanation:

Answer:

Esperanza describes the Vargas kids, while she described earlier as being bad. They have a single mother, Rosa Vargas, who is overwhelmed by and unable to control her many children, and who is still sad about the fact that their father left her without a note or any money to help.

Twelfth grade
T.3 Choose punctuation to avoid fragments and run-ons UH9
You've won a new book cover
Which is the best way to complete the text?
After Hazel's family moved to Ireland, she and Denise were separated by the Atlantic
Ocean, but a prolific written correspondence sustained their friendship.
Ocean; but
Ocean, but
Ocean but
Submit

Answers

Answer:

The comma. Because you whould need a compound complex sentence to and a subordinating conjuction to use a semi colon.

Explanation:

Read the passage from "Homesick.
She repeated after me, making the four syllables into four separate words.
She got up and walked across the room, bowing and smiling. "Sew Ing Ma
Shing."
Part of me wanted to laugh at the thought of Lin Nai-Nai maybe meeting
Dr. Carhart, our minister, whose face would surely puff up, the way it
always did when he was flustered. But part of me didn't want to laugh at
all. I didn't like it when my feelings got tangled, so I ran downstairs and
played chopsticks on the piano. Loud and fast. When my sore arm hurt, I
just beat on the keys harder.
How does this interaction help the reader understand the relationship between Jean
and her amah?
They have a positive relationship, but it is easy for Jean to take out her
frustrations on Lin even though Jean feels bad about it.
Lin enjoys spending time with Jean but does not like the English lessons.
They have a negative relationship so Jean enjoys teaching Lin English sayings
that will make Lin look foolish when she talks to others.
Jean is in charge, and Lin depends on Jean to help Lin do her job.

Answers

Answer:

They have a positive relationship, but it is easy for Jean to take out her frustrations on Lin even though Jean feels bad about it.

Explanation:

Answer: They have a positive relationship, but it is easy for Jean to take out her frustrations on Lin even though Jean feels bad about it.

"The Diamond Necklace” by Guy de Maupassant.

Mathilde suffered ceaselessly, feeling herself born to enjoy all delicacies and all luxuries. She was distressed at the poverty of her dwelling, at the bareness of the walls, at the shabby chairs, the ugliness of the curtains. All those things, of which another woman of her rank would never even have been conscious, tortured her and made her angry. The sight of the little Breton peasant who did her humble housework aroused in her despairing regrets and bewildering dreams. She thought of silent antechambers hung with Oriental tapestry, illumined by tall bronze candelabra, and of two great footmen in knee breeches who sleep in the big armchairs, made drowsy by the oppressive heat of the stove. She thought of long reception halls hung with ancient silk, of the dainty cabinets containing priceless curiosities and of the little coquettish perfumed reception rooms made for chatting at five o’clock with intimate friends, with men famous and sought after, whom all women envy and whose attention they all desire.

When she sat down to dinner, before the round table covered with a tablecloth in use three days, opposite her husband, who uncovered the soup tureen and declared with a delighted air, "Ah, the good soup! I don’t know anything better than that,” she thought of dainty dinners, of shining silverware, of tapestry that peopled the walls with ancient personages and with strange birds flying in the midst of a fairy forest; and she thought of delicious dishes served on marvellous plates and of the whispered gallantries to which you listen with a sphinxlike smile while you are eating the pink meat of a trout or the wings of a quail.

She had no gowns, no jewels, nothing. And she loved nothing but that. She felt made for that. She would have liked so much to please, to be envied, to be charming, to be sought after.

She had a friend, a former schoolmate at the convent, who was rich, and whom she did not like to go to see any more because she felt so sad when she came home.

But one evening her husband reached home with a triumphant air and holding a large envelope in his hand.

"There,” said he, "there is something for you.”

What is most likely in the envelope?

Answers

Answer:

A diamond necklace

Explanation:

It's the title of the story and something she wants.

Answer:

It’s A

Explanation:

I took the test

A small boy by changing one letter out of the word cave

Answers

Answer:

huh?

Explanation:

what? this doesn’t make since.

What happens in the General Prologue of The Canterbury Tales?

Answers

Answer:

Hope it helps

Explanation:

The narrator opens the General Prologue with a description of the return of spring. He describes the April rains, the burgeoning flowers and leaves, and the chirping birds. ... The travelers were a diverse group who, like the narrator, were on their way to Canterbury. They happily agreed to let him join them.

Answer:

mndkhcjehjfbwujfbugckbuwegcouekogfkuewh

Explanation:

How does Della's reaction to the hair combs help develop the theme in ''The Gift of the Magi''

She hides her disappointment in the combs showing that gratitude is more important than satisfaction.

She pretends to like the combs showing that appreciation is more important than enjoyment.

She is shocked showing that thinking before acting is better the acting without thinking.

She is touched showing that the gesture is more imporant then the object.

Answers

Answer:

She is shocked showing that thinking before acting is better the acting without thinking.

Explanation:

Answer:

She is touched, showing that the gesture is more important than the object.

Explanation:

I got it right.

Daniel is writing about emergency steps to take if a fire breaks out in school. Whi most useful? O a sequence chart a timeline O a Venn diagram O a web diagram​

Answers

Answer:

a sequence chart

Explanation:

trust me bro

Answer:

The answer is A. a sequence chart

Explanation:

Choose the correct pronoun.


The teacher told ____students that we had won the game.

us

we

Answers

Answer:

First option

Explanation:

The answer is the first option or "us." The teacher told us students that we had won the game. Using us instead of we not only sounds correct but means the narrator of the sentence is referring to themselves as students.

Hope this helps.

pls help will give brainlest

Answers

Answer:

b

Explanation:i did this and passed can u pls mark be brainliest

Answer:

B

Explanation

b i would say but thats a hard one.

Part A: Several generations before Jim was born his family had been

Question 1 options:

A) Happy

B) Wealthy

C) Shunned

D) Poor Whites

Answers

Wealthy hope this helps

Question 3 of 10

Important rock-and-roll artists and groups in the 1990s and early 21st century
included which of the following?

O A. The Doors

B. The Coasters

C. Justin Timberlake

D. None of the above

SUBMIT

Please answer please

Answers

C. Justin Timberlake

None of the above are Important rock-and-roll artists and groups in the 1990s and early 21st century. The correct option is D.

Who are rock-and-roll artists?

Rock and roll artists are musicians who perform or create music in the rock and roll genre, which emerged in the United States in the 1950s and quickly became popular around the world. Rock and roll music is characterized by its use of electric guitars, drums, and bass, as well as its fast tempo, rhythmic beat, and lyrics that often focus on themes of youth, rebellion, and romance.

Rock and roll have evolved over the decades and have influenced many other genres of music, including pop, heavy metal, punk, and alternative rock, among others. Some of the most famous rock and roll artists of all time include Elvis Presley, Chuck Berry, The Beatles, The Rolling Stones, Led Zeppelin, Pink Floyd, and Jimi Hendrix, among many others.

Here in the question,

The Doors and The Coasters were popular rock-and-roll artists in the 1960s, and Justin Timberlake is a pop and R&B artist who became popular in the late 1990s and early 2000s. However, some important rock-and-roll artists and groups in the 1990s and early 21st century include Nirvana, Pearl Jam, Radiohead, Red Hot Chili Peppers, Green Day, Foo Fighters, The White Stripes, The Strokes, Coldplay, and Muse, among others.

Therefore none of the above is the correct option.

Learn more about arrow on:

brainly.com/question/12509484

#SPJ7

Other Questions
2) There are 500 calories in 5 servings of SourPatch Kids. How many calories per serving?How many calories are there in 8 servings? PLEASE HELP!! 15 Points for CORRECT ANSWER ( nOT POINT D) THANK YOU AND BRAINLIEST A paired t-test can be treated as an inference about the mean of differences between two experimental conditions for a single sample of independent subjects.A. TrueB. False 12 13 14 Qu frase es incorrecta? De nio, el hombre siempre jugaba en la selva. Carlos y Sofa vean muchas cosas interesantes and Costa Rica la semana pasada. Cuando yo era joven, yo miraba la tele de vez en cuando. Open Response 2 part A: Plant cells and fungal cells have many of thesame types of organelles. Structures X and Y are found in both plant cellsand fungal cells. Structure Z is found in plant cells, but not in fungal cells. A- What is party?XZ HELP PLEASE PLEASE PLEASE!!The function f(x) = 4x 8 is reflected across the y-axis, resulting in a new function, g(x). Write the EQUATION of g(x). Please show how you got it!!! are the triangles congruent? if they are, state how they are congruent. Plz help!In order for the parallelogram tobe a rectangle, x = [? ]13x+34910x+10 How will you display the contribution in your museum Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat