Answer:
it is number 3 .............
Answer:
Kinetic energy is the highest when the baseball is in the air.Potential energy is the highest when the ball is about to be thrown.Kinetic energy gets converted to potential energy when the ball stops flying in the air and falls on the ground.Potential energy is converted into kinetic energy when the ball is thrown.which enzyme attaches the ozaki fragments?
Answer:
DNA ligase,joins the okazaki fragments together into a single DNA molecule
Answer:
DNA ligase attaches the ozaki fragments.
Explanation:
In my thought it's the answer.
What affect do glass panels have on temperature google doc
Answer:
wdym
Explanation:
What is the contour interval of this map?
Answer:bird creek
Explanation:
Which fossils provide information as to the mode of formation of an oxygen-rich atmosphere by about 2 billion years ago?
Answer:
The fossils that provide information on the formation of an oxygen-rich atmosphere are the stromatilites from the Precambrian era. These are layered and columnar fossils consisting mainly of cyanobacteria which were the original life form back then. These bacteria took in carbon dioxide and produced oxygen by photosynthesis as early as 2.5 billion years ago (the earth is about 4.5 billion yrs old).
Explanation:
Higher energy contained in the sugar molecules produced by photosynthesis comes from
A. light
B. water molecules.
C. ΑΤΡ.
D. carbon dioxide molecules.
Answer:
A
Explanation:
light
ffjcddssdfghcxdsssswefgcfdd
What is the optimal pH for Enzyme B?
Answer:
6,7.77.0
Please correct Ok ?
The most important part of mitosis is to correctly divide the
Cell membrane
Cytoplasm
DNA
Organelles
Answer:
DNA
Explanation:
help idk this answer
Answer:
d
Explanation:
How are cancerous cells different from normal cells?
Answer:
Cancer cells differ from normal cells in many ways that allow them to grow out of control and become invasive. One important difference is that cancer cells are less specialized than normal cells. That is, whereas normal cells mature into very distinct cell types with specific functions, cancer cells do not.
Explanation:
Hope this helps ya!!
What are internal structures?
Answer:
Internal structures are the inner pieces and parts that keep organisms alive, help them grow, and help them reproduce.
Explanation:
1. Compare and contrast mitosis and meiosis. 2. What major event occurs during interphase?
Answer:
1.
contrast between mitosis and meiosis
Mitosis
- it takes place in somatic cells in multi cellular organisms in order to provide growth, however, in unicellular organisms it is reproductive division as well. is the means of reproduction in single-celled organisms. Other organisms use it for the growth of tissues (somatic cells)
- exact number of chromosome in offspring
- no recombination or crossing over
- no pairing found
- major phase: prophase, metaphase, anaphase, telophase
Meiosis
- takes place in sex cells to form gamete formation during sexual reproduction
- half of the chromosome number found in gametes of the parents thus, known as reduction division
- due to crossing over takes place recombination found.
The pairing of chromosomes takes place
- major steps:
Meiosis 1 – prophase, Metaphase, anaphase, Telophase, and
Meiosis 2: Prophase, Metaphase, Anaphase, and Telophase
2. Interphase takes place prior to both mitosis and meiosis which is divided into 3 sub phases-G1, S and G2 phases.
The major events are as follows:
G1- RNA and protein synthesis takes place and cell grows in size
S- DNA replication takes place, Centriole duplication occurs and synthesis of histone proteins.
G2- RNA and Protein synthesis continues.
If the atomic number of an element is 6 and its mass number is 13, how many neutrons
are
contained in the nucleus?
19
8
7
6
Answer:
There will be 7 neutrons in a carbon isotope with an atomic mass of 13.
Explanation:
The number of protons in the carbon isotope will be the same as the atomic number, 6, so if we need an atomic mass of 13 there will be 7 neutrons, as 6+7=13.
If the atomic number of an element is 6 and its mass number is 13, there will be 7 neutrons. Therefore, the correct statement is option C.
What is atomic number?Atomic number is the number of protons found in the nucleus of an atom of a specific chemical element. The atomic number is also equal to the number of electrons orbiting around the nucleus in a neutral atom.
Mass number is the total number of protons and neutrons found in the nucleus of an atom and is represented by the symbol A. The mass number is used to determine the atomic mass of the atom.
The atomic number of an element is the number of protons present in its nucleus, which is 6. The mass number of an element is the total number of protons and neutrons in its nucleus, which is 13. So, the number of neutrons in the nucleus can be calculated by subtraction of the atomic number from the mass number.
The formula is number of neutrons = Mass number - Atomic number.
Therefore, there are 7 neutrons in the nucleus of the given element.
Learn more about the atomic number here:
https://brainly.com/question/16858932
#SPJ2
can somebody do 4 and 5 for me
Answer:
4. According to what is observed in the diagram, the maltose (substrate) binds to the maltase (enzyme) to obtain glucose molecules (product), in a process of hydrolysis of the maltose.
5. Three factors that can affect intestinal maltose activity - slowing it down or stopping it - are temperature, pH and substrate depletion.
Explanation:
4. Enzymes, such as maltase, have the function of making a reaction faster and decreasing the activation energy. Maltase is responsible for breaking down a maltose molecule, a dimer, into two glucose monomers, which is a hydrolysis reaction of the bonds that hold glucose molecules together.
5. There are several factors that can cause the decrease or cessation of the activity of an enzyme. Enzymes are activated when substrate is available and work best under ideal temperature and pH conditions. When there are alterations of these factors, the enzyme will reduce or stop the reaction in which it intervenes.
pH: when the pH increases or decreases it produces a decrease in the speed of reaction that catalyzes an enzyme. Very high or low pH levels can denature the enzyme and make the expected reaction not occur. Temperature: like pH, changes in temperature can slow or stop maltase activity. Substrate availability: It is a fact that when the specific substrate of an enzyme becomes depleted, the rate of reaction slows down, stopping when no substrate is available.Question 2 of 9
Corn seeds were germinated (grew and put out shoots after a period of dormancy) in a dark room
placed in the light, 75 of these seedlings turned green. Which conclusion about chlorophyll (the
plants can most reasonably be drawn from this information?
(1 point)
DA. Light is the only factor that controls the production of chlorophyll
.
B. Darkness is the only factor that prevents the production of chlorophyll.
IC Light and vitamins are necessary for chlorophyll production.
D. Light and some other factor are necessary for chlorophyll production.
----Page 2 of 9----
Answer:
The correct answer is option D. Light and some other factors are necessary for chlorophyll production
Explanation:
By this experiment, it is clear that light is the major factor that helps in the production of chlorophyll in seedlings or plants. In this study, placing the seeds in the light turns 75 seedlings green which is possible by the production of the green pigment, chlorophyll only. So, it is proved that light is a key factor in the production of chlorophyll.
Besides light, there must be some other factors (mineral nutrition and chemical metabolites) that also play role in the production of chlorophyll or increase or decrease of the chlorophyll production as few seedlings did not turn green in the study.
Which categories of amino acid would you expect to find on the surface of a soluble protein, and which would you expect to find in the interior? What distribution of amino acids would you expect to find in a protein embedded in a lipid bilayer?
Answer:
Polar and charged amino acid residues (the remainder after peptide bond formation) are more likely to be found on the surface of soluble proteins where they can interact with water, and nonpolar (e.g., amino acid side chains) are more likely to be found in the interior where they are sequestered from water.
Explanation:
The amino acids with POLAR and CHARGED side chains are expected to be observed on the membrane surface, whereas amino acids with NON-POLAR and HYDROPHOBIC side chains are expected to be found inside the lipid bilayer.
The lipidic bilayer is mainly composed of phospholipids.Phospholipids have hydrophilic, polar phosphate heads facing out on each surface to interact with water and hydrophobic fatty acid tails facing each other inside the lipid bilayer.The polar and charged side chains of amino acids are expected to be observed on the surface of membrane proteins because they can interact with water (H2O) molecules.On the other hand, nonpolar side chains of specific amino acids are expected to be observed inside the lipid bilayer to interact with the hydrophobic fatty acid tails of phospholipids.The polar amino acids include glutamine, glutamic acid, arginine, asparagine, aspartic acid, histidine, lysine, serine, and threonine.Moreover, amino acids with hydrophobic side chains include leucine, isoleucine, glycine, alanine, valine and proline.In conclusion, amino acid residues with POLAR and CHARGED side chains are expected to be observed on the membrane surface, whereas amino acids with NON-POLAR and HYDROPHOBIC chains are expected to be found inside the lipid bilayer.
Learn more in:
https://brainly.com/question/4535258?referrer=searchResults
which best describes the results of mendels work with pea plants a) he figured out the fastest way to grow pea plants. b) he showes that pea plants do not pass traits to their offspring. c) he found the basic ideas about genetics. d) he discovered the scientific method.
Answer:
its C
Explanation:
For the last 30 years, human use of fertilizers has had a significant impact on the nitrogen
cycle. Which statement explains how fertilizers impact an ecosystem?
O Fertilizers increase the amount of fixed nitrogen available in the ecosystem.
O Fertilizers decrease the amount of nitrogen fixed by organisms living in the ecosystem.
O Fertilizers kill off important nitrogen fixing bacteria.
Fertilizers decrease the amount of fixed nitrogen available in the ecosystem.
Answer:
It's C
Explanation:
Hope this helped :)))
The fertilizers show a significant impact on the nitrogen cycle as the fertilizers kill off the important nitrogen fixing bacteria which are present in the soil. Thus, the correct option is C.
What is Nitrogen cycle?Nitrogen Cycle is a biogeochemical process through which the nitrogen present in the environment is converted into many different forms, consecutively passing from the atmosphere to the soil to the living organisms and back into the atmosphere after decomposition. It involves several processes including the nitrogen fixation, nitrification, denitrification, decay and putrefaction of the nitrogen compounds.
Intensive fertilization of the agricultural soils of normal soil can increase the rates at which nitrogen in the form of ammonia is volatilized in the environment and lost to the air. It can also speed the microbial breakdown of ammonium and nitrates in the soil which results into enhancing the release of nitrous oxide. In addition to this, excessive use of fertilizers also kills the nitrogen fixing bacteria present in the soil.
Therefore, the correct option is C.
Learn more about Nitrogen cycle here:
https://brainly.com/question/1615727
#SPJ2
Rough ER is mostly responsible for
making -__-, whereas smooth ER is
mostly responsible for making
Explanation:
The rough ER, studded with millions of membrane bound ribosomes, is involved with the production, folding, quality control and despatch of some proteins. Smooth ER is largely associated with lipid (fat) manufacture and metabolism and steroid production hormone production.
Which cell organelle is most responsible for ensuring that the cell obtains the necessary materials to maintain homeostasis?
Answer:
i’d say mitochondria
Explanation:
mitochondria is the “powerhouse of the cell”
Alana wants to measure the speed at which drops of precipitation fall to the ground in Los Angeles.
Which statement identifies a way Alana uses technology to complete her experiment?
O She observes daily rainfall data from multiple weather stations throughout the city.
O She graphs the relationship between rainfall speed and time using graphing paper.
O She analyzes a map to determine different places to collect rainfall for the study,
O She estimates how fast rain falls by studying the sky at different locations in the city.
Answer:
She observes daily rainfall data from multiple weather stations throughout the city.
Explanation:
Explain how exercise and an active lifestyle can improve bone health
and bone density.
Include discussions of osteoblasts vs.
osteoclasts, osteoids, osteocytes, collagen, bone modeling, impact
and increased workload, glucocorticoid effects, mineral intake, or
underloaded bone.
Explanation:
explain how exercise and an active Lifestyle can improve bone health and bone density include discussions of
What type of cloud is Cloud A? What kind of weather might you expect when you see clouds of this type?
Answer:
Cloud A is a cumulus cloud. When these fluffy, white clouds are in the sky, you can expect fair weather.
Explanation:
most bacteria reproduce by
Answer: Most bacteria rely on binary fission for propagation.
Explanation: Hope this helps have a great day!
Answer: Most bacteria reproduce by binary fission, also know as propagation.
The Ebola virus can often have symptoms similar to bacterial pneumonia, an infection of the lungs. These symptoms include chest pains, shortness of breath, and fever. Which statement best summarizes the differences between these two diseases? (SC.6.L.14.6)a.Viruses can replicate because they are living organisms, while bacteria cannot. b.Viruses are not living organisms, but bacteria are living. c.Viruses can be beneficial to live organisms but bacteria are often infectious. d.Viruses are living organisms, while bacteria are not.
Answer:
Eblow is a terrible thing.
Explanation:
Answer:
I think its, option b) Viruses are not living organisms, but bacteria are living.
Explanation:
The other options don't fit "summarize the differences b/w bacteria and virus", or simply don't make sense...
Bacteria can replicate as well, not only virus, so that cannot be a difference
The virus is often the one being more dangerous, there is something called "good bacteria"
A virus isn't living, (for the sake of this answer), and we all know for sure that bacteria is living
So, that's how option b is correct
I hope this helped you!!
Which mutation below would result in the greatest amount of change in the proteins that code for a particular trait?
(Please help I will reward)
A. inserting three nucleotides
B. deleting three nucleotides
C. deleting one codon
D. deleting two nucleotides
Answer:
Mutations are errors in codons caused by changes in nucleotide bases. Some mutations may not have much effect. For example, if the codon GAA becomes the codon GAG, because the genetic code is degenerate, the codon will still code for the amino acid glutamate. Such ineffectual mutations are called silent mutations. Some mutations, however, can have a huge affect on coding for amino acids, which can in turn affect what proteins are produced, which can have a profound effect on cellular and organismal function.
Identify the three types of neurons, and explain the function of each type
Answer:
Sensory neurons help you:
taste
smell
hear
see
feel things around you
Explanation:
Motor neurons
Motor neurons play a role in movement, including voluntary and involuntary movements. These neurons allow the brain and spinal cord to communicate with muscles, organs, and glands all over the body.
Interneurons
Interneurons are neural intermediaries found in your brain and spinal cord. They’re the most common type of neuron. They pass signals from sensory neurons and other interneurons to motor neurons and other interneurons. Often, they form complex circuits that help you to react to external stimuli.
Genetic counselors work mostly with
1 school counselors.
2 researchers in genetic engineering.
3 elderly adults who live in care facilities.
4 couples who are planning to have children.
Answer: couples who are having children
Explanation:
I got it right on my quiz
Plants and animal cells are examples of
cells
O prokaryotic cells
O eukaryotic cell
Answer:
eukaryatic which the RH whitthakar was divided PLANTAE and animalia kingdoms in eukaryotes
What methods would the body use to provide a
person with energy throughout a race?
DONE
C
Intro
Answer:
The methods the body would use to provide a person with energy throughout a race is using the ATP in the muscle cells for the first 3 seconds.
For the next 8 to 10 seconds, the body replaces the used ATP and produces more.
Within the next 90 seconds of the race, anaerobic respiration is used up to make more ATP (Adenosine triphosphate).
Therefore, during the whole process, the three energy systems used are:
the ATP-PC System
the Glycolytic system
the Oxidative system
Answer:
The methods the body would use to provide a person with energy throughout a race is using the ATP in the muscle cells for the first 3 seconds.
For the next 8 to 10 seconds, the body replaces the used ATP and produces more.
Within the next 90 seconds of the race, anaerobic respiration is used up to make more ATP (Adenosine triphosphate).
Explanation:
What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
Answer:
what I don't understand what is the Ctcagt