which contribution did george childress make to the texas revolution ??
a: he was chair of the convention of 1836.
b: he was the first president of the republic of texas.
c: he was the author of the texas declaration of independence.
d: he was the commander-in-chief of the texas military

Answers

Answer 1

Answer:

C.

Explanation:

George Campbell Childress was a lawyer and statesman born January 8, 1804. Childress is also an author of Yexas Declaration of Independence.

After Childress had sufficient money to move to Texas, he left for Texas forever. On December 13, 1835 he arrived on the shores of Red River. In 1836, Childress along with five members of council began drafting Declaration of Independence.

So, the correct answer is option C.

Answer 2

Answer:

Answer Is C

Explanation:

I Took The Test


Related Questions

can u pls answer the second one

Answers

Answer:

I can't see clear

Explanation:

Which best describes a development that improved railroad safety?
Railroads adopted standard time to coordinate schedules.
Railroads offered fold-down beds so that people could sleep more comfortably.
Companies standardized track technology so that they could use each other’s tracks.
Companies replaced hand-operated brakes with air brakes on trains.

Answers

Answer:

The answer should be: Companies replaced hand-operated brakes with air brakes on trains.

Explanation:

You have to think how hard it was for trains to stop with hand operated brakes. Trains go fast, and not stopping in time can be dangerous. Hope this helped :)

Answer:

Companies replaced hand-operated brakes with air brakes on trains.

Explanation:

Edge 2020.

What is the earliest memory you have?

Answers

Answer:

my earliest was when my dad left lol

My earliest memory is getting a new puppy.

Why were some Americans upset with the treaty that John Jay negotiated with the British in 1795?
Answer choices:
A)the British refused to give the Ohio valley territory over the America
B)the British did not agree to stop the practice of “impressment” of US sailors
C)the British demanded that Americans pay the British back for the American
D) the Americans did not think it was fair they had to pay back their debts to the British

Answers

B) the British did not agree to stop the practice of "impressment" of US sailors.

John Jay failed to negotiate an end to the impressment of US sailors, which angered many Americans due to being a longstanding issue on the high seas.

What gave Swahili stonetowns their name

Answers

Their city states and their multi story anime homes

How did the Progressive movement improve conditions for workers? Check all that apply.
1.) Working hours were reduced in many states.
2.) Strikes were no longer needed to have workers' demands met.
3.) Child labor became illegal in all states.
4.) Workers were able to negotiate better pay with employers.
5.) Workplace safety was improved.

Answers

1,3,4,5 are all valid answers

Answer:

1, 4, 5

Explanation:

just took the test

How many muscles are found in the human body?

Answers

Answer:

more that 600

Explanation:

that's was Google told me

Janelle thinks that genetic engineering could be used to make a larger fruit rather than cloning the fruit. Which would best support her point of view? Genetic engineering does not cost as much. Genetic engineering does not result in genetically identical organisms. Genetically engineered foods never cause allergies in people. Genetically engineered foods have not been modified.

Answers

Answer:

The correct answer is B.

Explanation:

Genetic engineering is the process of using rDNA to modify the genetic makeup of an organism. So the correct answer is Option B.

Hopefully, this helps! :D

Ask your question below!

Answer:

B

Explanation:

Can someone pass help me with this question I need help!!!

How does paragraph 5 contribute to the development of ideas in the text?

Answers

Answer:

because it send the food for their survival and soldiers for their support and civilians to settle the problem

Answer:

They were trying to explain in that paragraph that even someone as strong as the South with there 7 our of 8 military groups out, they couldn't be helpful to the soldiers. Also because it send the food for their survival and soldiers for their support and civilians to settle the problems

Hope I helped!!

What was the Zhou Dynasty.

Answers

Answer:

The Zhou Dynasty (1046-256 BCE) was among the most culturally significant of the early Chinese dynasties and the longest lasting of any in China's history. It is divided into two periods: Western Zhou (1046-771 BCE) and Eastern Zhou (771-256 BCE). It followed the Shang Dynasty.

Explanation:

Answer:

The Zhou Dynasty (1045–221 BC) saw China grow, fracture into states, then unite in imperialism. It was technically the longest dynasty, though the Zhouhad effectively lost power by 770 BC. Major philosophies and religions emerged that were the basis of Chinese belief in later eras, such as Confucianism and Daoism.

Explanation:

Whats the baby's name in Lamb to the Slaughter

Answers

The lamb slaughter is 18 terms!

Answer:

there was no baby?

Explanation:



Which one WAS NOT a strength of the Articles of Confederation?

Answers

Answer:

just. check online that is the fastest way

Answer:

1.Congress had no power to coin money, therefore each state developed its own currency.

Explanation:

What were some of the areas that Christianity spread to by a.d. 325?

Answers

Answer:

Christianity in the 4th century was dominated in its early stage by Constantine the Great and the First Council of Nicaea of 325, which was the beginning of the period of the First seven Ecumenical Councils (325–787), and in its late stage by the Edict of Thessalonica of 380, which made Nicene Christianity the state

Explanation:

Use the following image to answer the question.

D
↑ ↑
C E
↑ ↑
B F

A

The state of Vermont sued the State of New York for a law passed in New York. Vermont said that the law unfairly affected business owners in Vermont who sold goods in New York. Vermont claimed the New York law violated federal laws. Where would this case be decided?
A) A state trail court in New York, represented by section F.
B) A federal appellate court in Vermont, represented by section B.
C) The Vermont Supreme Court, represented by section E.
D) The U.S. Supreme Court in Washington, D.C., represented by section D.

Answers

Answer:

Option D

Explanation:

The U.S. Supreme Court in Washington, D.C., represented by section D.

;)

Answer: D

Explanation:

The Supreme Court would look at this case because there would have to be both Vermont and New York. If it were decided in New York, no one representing Vermont would be there. The answer is D.

How was the Market revolution changing the
United states?

Answers

Answer:

In the 1820s and 1830s, a market revolution was transforming American business and global trade. Factories and mass production increasingly displaced independent artisans. Farms grew and produced goods for distant, not local, markets, shipping them via inexpensive transportation like the Erie Canal.

Explanation:

HOPE THIS HELPS ;}


The nation fought against the British in the French and Indian war
O Miami
O Huron
O Iroquois
O Anishinaabe

Answers

Answer: Iroquois

Explanation: The Iroquois fought alongside the French, and the Ohio tribes fought alongside the British.

Answer:

C:Iroquois

Explanation:

The main enemies in the war were the French and the British. Both sides had American Indian allies. The French allied with several tribes including the Shawnee, Lenape, Ojibwa, Ottawa, and the Algonquin peoples. The British allied with the Iroquois, Catawba, and the Cherokee (for a time).

Which statement best describes the wives and concubines occupying the sultan’s harem?

Answers

Answer:

Each competed to have her own son chosen as the sultan’s heir.

Explanation:

What was one effect of women being denied the right to speak at abolition rallies?

Women stopped campaigning against abolition.

Women focused on the temperance movement.

Women met to improve their domestic skills.

Women began to fight for more equal right

Answers

The answer to your question is

Woman stopped campaigning against abolition.
I hope this helped :)))

Answer:

D: Women began to fight for more equal rights.

how did the enlightenment idea of popular sovereignty influence the American Revolution ​

Answers

Answer: it gave the people and example

Explanation:

In what ways were the Eastern and Western branches of Christianity different?

Answers

Answer:

The language and rituals used in worship

Explanation:

The Eastern branch of Christianity was influenced by Middle East traditions and culture—they spoke and wrote in Greek rather than Latin and their religious ceremonies emphasized mystery and beauty. The Western branch was influenced by Western European culture—they spoke and wrote in Latin, and their rituals were more austere, emphasizing discipline and contemplation.

17. What did the Non-Intercourse Act do?
A. It prohibited American trade with Britain and France only.
B. It repealed the Sedition Act.
C. It ended the War with the Barbary Pirates.
D. It prohibited American trade with all countries.

Answers

Answer:

A. It prohibited American trade with Britain and France only.

Explanation:

i took the quiz

The Non-Intercourse Act do It prohibited American trade with Britain and France only. Thus the correct option is A.

What is trade?

Trade is referred to as buying and selling goods in exchange for money. This trade is performed internationally with the help of import and export where different countries send or receive goods from other countries.

The Non-Intercourse Act permitted the resumption of international trade but prohibited French and British merchants from entering American ports since it allowed commerce only with England and France.

This act allows trade with all the countries due to its treaty with them but it restricts their trade with Britain and France only as they are considered European countries.

Therefore, option A prohibited American trade with Britain and France only is appropriate.

learn more about Non-Intercourse Act, here:

https://brainly.com/question/8513784

#SPJ5

Canada is divided into political areas called...

A)states and territories
B)regions and states
C)provinces and states
D)territories and provinces

Answers

Answer:

D

Explanation:

Answer:

D

Explanation: Got it right hope this helps

In what ways did the 1920s represent the benefits of interconnectedness?

Answers

Explanation:

Global Interconnectedness refers to the ability to understand and function in an increasingly multicultural, international, yet interconnected environment. It fosters the development of individuals to become successful professionals, civic leaders, and informed citizens in a diverse national and global society.

Answer:

In the 1920s, there was a huge boom of culture and new technology. Economies were recovering from war, and consumer consumption exploded. In this world, it was absolutely essential to maintain good connections and relations with your other partners in business or other parts of your company to maximise profit. Also, interconnectedness allowed people to communicate across the globe, accelerating the switch of culture and adding a lot of spice to people across the globe.

Explanation:

Hope this helped!

In both Britain and the United States, what happened in the 1870s that limited child labor? As unions became stronger, they didn’t allow children under 14 to work. Laws passed in both countries prohibited children under 14 from working. Laws passed in both countries limited children to work only 8 hours a day. Compulsory education and attendance laws were passed in both countries.

Answers

Answer:

D. Compulsory education and attendance laws were passed in both countries.

Explanation:

Got it correct on Edge

In both Britain and the United States, Compulsory education and attendance laws were passed in both countries in the 1870s that limited child labor. Thus the correct answer is D.

What is child labor?

When children are not allowed to go to schools and get exploited in factories or industries in a very young age which disturbs their childhood is known as child labor.

The causes of child labor are poverty and unemployment which leads to children working in factories to earn their livelihood. Poverty restricts them to seek education which causes them to involved in such activities.

In the 1870s Compulsory education and attendance laws were passed in both Britain and the United States which restricts child labor and made it compulsory for every child to go and attend school and seek better education for growth.

Therefore, option D is appropriate.

Learn more about child labor, here:

https://brainly.com/question/12088098

#SPJ5

Come up with something that goes with a car and found In the 1920s. Have to come up with a slogan also!!!
PLEASE HELP ITS DUE TOMORROW!!!!

Answers

Answer:

Crogan

Explanation:

its a good sling

pls help me and don't answer if you just want points Identify two examples of cruel things that were done to slaves as noted in the narratives?

Answers

Answer:

They had numbers branded on their backs, were beaten, and were starved sometimes

Explanation:

What Ming political and economic policy does this excerpt provide an example of?

commercialism
Confucianism
kowtowing
isolationism

Answers

Answer:

isolationism on edge2020

Answer:D

Explanation:

on edge

Explain How did the republic's structure of government change and develop over time?

Answers

Answer:

Government pioneers cut some of Rome's most vital laws into 12 extraordinary tablets. The Twelve Tables, as they came to be known, were the main Roman laws set in motion. Despite the fact that the laws were fairly cruel by the present gauges, they guaranteed each resident equivalent treatment under the law.

Explanation:

Ok so I am almost 100% this is the answer

What happened to Parliament after the restoration of the monarchy?
A. it was abolished
B.it saw its power reduced
C. it was given power shared with Charles II D. it ruled supreme

Answers

Answer:

Sorry if im wrong but its either b or d based of what I read

Explanation:

Restoration, Restoration of the monarchy in England in 1660. It marked the return of Charles II as king (1660–85) following the period of Oliver Cromwell's Commonwealth. The bishops were restored to Parliament, which established a strict Anglican orthodoxy.

Answer:

Its B

Explanation:

I took the test

Pls mark brainlest :)

The Akkadians migrated to Mesopotamia from __________. A. India B. Arabia C. Turkey D. Palestine Please select the best answer from the choices provided

Answers

The Akkadians migrated to Mesopotamia from Arabia. Therefore, the correct option is B.

The Akkadians were a group of people who lived in Mesopotamia during the third millennium BCE. They are best known for their creation of the Akkadian Empire, which was the first empire in world history.

The Akkadians are considered one of the earliest civilizations in human history, and their legacy can still be seen in the modern world through their contributions to art, literature, and language.

Thus, the ideal selection is option B.

Learn more about  Akkadians here:

https://brainly.com/question/30272873

#SPJ1

Other Questions
What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists? About 1/5 of all adults in the United States have type O blood. If four randomly selected adults donate blood, find the probability of each of the following events. a. All four are type O. b. None of them is type O. c. Two out of the four are type O . Whats the answer for this question guys??? a copper ore contains 3.00% of copper carbonate, CuCO3, by mass. Which mass of copper would be obtained from 1 tonne of the ore? A 1.91kg B 3.71kg C 15.3kg D 58.4kg If you travel 7.5 km and walk for 1.5 h, what is your average speed? Show your work? what is the role of private security within the criminal justice system How does the U.S. Constitution best reflect the ideal of separation of powers? Giving brainliest In the equation 3x+7=15, the number 7 is a. At Summer camp, campers are divided into groups. Each group has 16 campers and 2 cabins. How many cabins are needed are needed for 48 campers? A: 14 B: 20 C: 6 D: 30 What kind of heritability estimates (broad sense or narrow sense) are obtained from human twin studies? The length of a rectangular deck is 5 times its width. If the decks perimeter is 24 feet, what is the decks area?